We narrowed to 8 results for: loxP
-
TypeCollection...recombinase recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how the... putting the loxP sites on either side of a gene (called “floxing”, for “flanked by loxP”), will permit...IRES-EGFP Mammalian Costantini 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE Cre activates your gene fused...more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible reporter... reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP Switches from DsRed to eGFP expression...expression Mammalian Green 32145 pJFRC172-10XUAS-loxP>-dSTOP-loxP>-myr::GFP Cre dependent myr-GFP expression...recombinases that recognize specific mutant loxP sites, VloxP and SloxP sites respectively. Split Cre: Cre recombinase...
-
Retrovirus Plasmids
TypeCollection...puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Flp recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to ... -
Zhang Lab CRISPR Page
TypeCollection...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ... -
Zebrafish Plasmid Collection
TypeCollection...Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise temporal and spatial... -
CRISPR History and Development for Genome Engineering
TypeCollection...mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed repair... -
Validated gRNA Sequences
TypeCollection...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Penn Vector Core Partnership with Addgene
TypeCollection... AV-1-PV2699 100030-AAV1 pAAV.CBA.loxP.ArcLightD.2A.nlsmCherry.loxP.WPRE.SV40 Lawrence Cohen AV-1-PV3509...