We narrowed to 9 results for: loxP
-
TypeCollection... Placing the loxP sites on either side of a gene (called "floxing", for "flanked by loxP"), will permit...strand exchange at a specific target site (called loxP for Cre, or FRT for Flp). The nature of the DNA ...target site orientation. A) If the target sites (loxP) are on the same DNA strand in opposite directions... Sequence Structure (Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted...strategies. Gene Expression: A stop codon flanked with loxP sites (often called a "lox-STOP-lox" or "LSL" cassette...
-
Retrovirus Plasmids
TypeCollection...puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Flp recombinases to remove genes flanked by either loxP or FRT sites respectively, and empty vectors to ... -
Bacterial Expression Systems
TypeCollection...Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity Fluorescence ... -
Zhang Lab CRISPR Page
TypeCollection...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ... -
Zebrafish Plasmid Collection
TypeCollection...Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise temporal and spatial... -
CRISPR History and Development for Genome Engineering
TypeCollection...mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed repair... -
Validated gRNA Sequences
TypeCollection...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Penn Vector Core Partnership with Addgene
TypeCollection... AV-1-PV2699 100030-AAV1 pAAV.CBA.loxP.ArcLightD.2A.nlsmCherry.loxP.WPRE.SV40 Lawrence Cohen AV-1-PV3509...