Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 48 results for: mcs

Showing: 21 - 40 of 48 results

  2. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...138152 pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro Lentiviral vector expressing destabilized EGFP...

  6. Sequencing Primers

    Type
    Guide
    ... 3' of MCS in pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE...GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector...5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC...Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...end of IRES Reverse L4440 AGCGAGTCAGTGAGCGAG 5' of MCS in L4440 vector Forward LacI-R GGCATACTCTGCGACATCGT...td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors Reverse pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...pGP704-R AACAAGCCAGGGATGTAACG R6K gamma origin, 3' of MCS in pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC...

  8. Bacterial Expression Systems

    Type
    Collection
    ...pneumoniae Jan-Willem Veening 188978 pREDawn-AmpR-MCS FixK2 Red light (660 nm) Escherichia coli Heikki ...tuberculosis Vinay Nandicoori 188974 pREDusk-AmpR-MCS FixK2 Red light (660 nm) Escherichia coli Heikki ...

  9. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...recipient plasmid (usually in the Multiple Cloning Site (MCS)), but do not cut elsewhere on the plasmid. Bonus...orientation in the recipient plasmid by viewing the MCS and fusing the upstream restriction site to the forward...

  13. Control AAV Preps

    Type
    Collection
    ...Constitutive 1 Karl Deisseroth 105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick...

  14. Molecular Biology Reference

    Type
    Guide
    ...advantage to the bacterial host. Multiple Cloning Site (MCS) A short segment of DNA which contains several restriction... As a general rule, the restriction sites in the MCS are unique and not located elsewhere in the plasmid...plasmid backbone. In expression plasmids, the MCS is often located downstream from a promoter to drive expression... promoter, or other DNA fragment cloned into the MCS. The insert is typically the genetic element being...bacterial resistance gene, origin of replication, and an MCS. They are small and optimized to help in the initial...

  17. Molecular Cloning Techniques

    Type
    Guide
    ...sites, usually within the multiple cloning site (MCS). You can easily move (subclone) any piece of DNA...the same sites in the same orientation within its MCS. Due to their short length, it is also easy to add...

  18. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...primer containing the desired restriction site (the MCS has several options) and a pUCX-specific reverse ...region. The PCR product is then ligated into the MCS/SacI site in pUCXKT, removing the stop codons during...
Showing: 21 - 40 of 48 results