We narrowed to 3 results for: mcs

... 3' of MCS in pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE...GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector...5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC...Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...end of IRES Reverse L4440 AGCGAGTCAGTGAGCGAG 5' of MCS in L4440 vector Forward LacI-R GGCATACTCTGCGACATCGT...td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors Reverse pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...pGP704-R AACAAGCCAGGGATGTAACG R6K gamma origin, 3' of MCS in pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC...

...advantage to the bacterial host. Multiple Cloning Site (MCS) A short segment of DNA which contains several restriction... As a general rule, the restriction sites in the MCS are unique and not located elsewhere in the plasmid...plasmid backbone. In expression plasmids, the MCS is often located downstream from a promoter to drive expression... promoter, or other DNA fragment cloned into the MCS. The insert is typically the genetic element being...bacterial resistance gene, origin of replication, and an MCS. They are small and optimized to help in the initial...

...sites, usually within the multiple cloning site (MCS). You can easily move (subclone) any piece of DNA...the same sites in the same orientation within its MCS. Due to their short length, it is also easy to add...