We narrowed to 47 results for: puro

...expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX_...

...pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro IRES Retroviral pEF1a-IRES-Neo IRES Mammalian ...

.... Lentiviral Nadav Ahituv 212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating...controlling transcription Pete Stecha 212933 pGL4.82(hRluc/Puro) Renilla Vector for investigating regions controlling...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...firefly luciferase Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression of firefly...Venus-Aka-luciferase Roland Friedel 102320 FUW-RLuc-T2A-PuroR Renilla Ubc Lentiviral Expression of Renilla luciferase...

...Weber 173220 pPBT-peRNA_GG-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222...pPBT-PE2-PuroTK-pegRNA_GG Mammalian, piggyBac hU6 pegRNA BsmBI Yes (Cas9 H840A + MMLV RT) PuroTK Jacob Giehm...

... 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control...

...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...

...Autophagosomes LC3 mCherry David Rubinsztein 38277 pMXs-puro GFP-p62 Autophagosomes Sequestosome-1 EGFP Noboru... H2B mRFP Bryan Welm , Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999...

...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...to fresh puromycin-containing media every other day. f. The minimum concentration of puromycin that results...with finer increments of puromycin to determine a more precise optimal puromycin concentration.) F.3. Protocol...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...positive control for the puromycin selection. Days 4+: g. Change to fresh puromycin-containing media as needed...

...Nathans, Daniel. "Puromycin inhibition of protein synthesis: incorporation of puromycin into peptide chains...Yarmolinsky, Michael B., and L. Gabriel. "Inhibition by puromycin of amino acid incorporation into protein." Proceedings...

...-dCas9-p300 Core, as well as pLV-dCas9-p300-P2A-PuroR for lentiviral expression. Figure 1: dCas9... deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation in mammalian cells... cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells. Grant Challen...

...marker such as puromycin, you can (also) select for the positive colonies by puromycin selection. You ...transfected cells (for example, plasmid with a puromycin resistance cassette, such as PX459). After you...

...stably integrate a reporter gene that contains a puromycin resistance gene followed by the target site (the...genome edit:  A donor plasmid that contains a puromycin resistance gene linked to an in-frame H2B-GFP....

...shared by bacteria and eukaryotes. For example, puromycin inhibits protein synthesis across kingdoms by ...targeting a shared aspect of ribosomal function. A puromycin resistance gene on your vector can protect both...

...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...the genome. In this work, they use AAVS1_Puro_PGK1_3xFLAG_Twin_Strep and nuclease driven recombination ...

...different selection markers (blasticidin, neomycin, puromycin, hygromycin) and fluorescent protein reporters...

...CD90.1 selection marker, Thy1.1, in addition to puromycin resistance.  The MYC-CRISPR library targets E-...

...Using translation inhibitors cycloheximide and puromycin, Halstead et al. verified that translation is ...

...80S; inhibits chain elongation. 50-500 ug/mL Puromycin pac HeLa, 293HEK, Jurkat T cells Inhibits protein...

...lentiviral backbones expressing blasticidin or puromycin resistance genes.  It’s that simple! Good luck...

...A., Smith, C. J., Ottolini, M., Barker, B. S., Purohit, A. M., Grippo, R. M., Gaykema, R. P., Spano, A...