We narrowed to 51 results for: puro
-
TypeCollection... plasmids with Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible lentiviral...Ligation Independent Cloning (LIC) pAG CMV Empty Puro - Empty mammalian expression plasmid for cloning...plasmids for Drosophila expression pMT-puro - Inducible gene expression under...lentiviral vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA...mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1...lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin Mammalian, Varies pLKO.1 hygro - Lentiviral...
-
Neurodegeneration Plasmid Collection
TypeCollection...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA... pLD-puro-Cc-PARK7C53A-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA...pLD-puro-Cc-PARK7E163K-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115187 pLD-puro-Cc-CR-PARK7WT-VA...Roussel 133753 pLVX-Puro-TDP-43-WT TARDBP CMV ALS Shawn Ferguson 133754 pLVX-Puro-TDP-43-A90V TARDBP CMV...Ferguson 133755 pLVX-Puro-TDP-43-A315T TARDBP CMV ALS Shawn Ferguson 133756 pLVX-Puro-TDP-43-A382T TARDBP...Ferguson 133757 pLVX-Puro-TDP-43-D169G TARDBP CMV ALS Shawn Ferguson 133758 pLVX-Puro-TDP-43-K263E TARDBP...Ferguson 133759 pLVX-Puro-TDP-43-M337V TARDBP CMV ALS Shawn Ferguson 133760 pLVX-Puro-TDP-43-P112H TARDBP... -
Zhang Lab CRISPR Page
TypeCollection...targeting efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n...2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro and single guide RNA 48873 : PX460; SpCas9n (D10A...) and single guide RNA 62987 : PX462; SpCas9n-2A-Puro (D10A nickase) and single guide RNA 48137 : PX165...2 vector system - lentiCas9-Blast and lentiGuide-Puro (sgRNA) Browse the Addgene GeCKO Library CRISPR ... -
Luciferase Plasmid Collection
TypeCollection.... Lentiviral Nadav Ahituv 212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating...controlling transcription Pete Stecha 212933 pGL4.82(hRluc/Puro) Renilla Vector for investigating regions controlling...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...firefly luciferase Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression of firefly...Venus-Aka-luciferase Roland Friedel 102320 FUW-RLuc-T2A-PuroR Renilla Ubc Lentiviral Expression of Renilla luciferase... -
CRISPR Plasmids - Prime Edit
TypeCollection...Weber 173220 pPBT-peRNA_GG-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222...pPBT-PE2-PuroTK-pegRNA_GG Mammalian, piggyBac hU6 pegRNA BsmBI Yes (Cas9 H840A + MMLV RT) PuroTK Jacob Giehm... -
CRISPR References and Information
TypeCollection... 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control... -
Sequencing Primers
TypeGuide... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Autophagosome LC3(ATG8) mCherry Maria Harrison 38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...to fresh puromycin-containing media every other day. f. The minimum concentration of puromycin that results...with finer increments of puromycin to determine a more precise optimal puromycin concentration.) F.3. Protocol...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...positive control for the puromycin selection. Days 4+: g. Change to fresh puromycin-containing media as needed... -
Visualizing Protein Turnover In Situ
TypeBlog Post...Nathans, Daniel. "Puromycin inhibition of protein synthesis: incorporation of puromycin into peptide chains...Yarmolinsky, Michael B., and L. Gabriel. "Inhibition by puromycin of amino acid incorporation into protein." Proceedings... -
CRISPR 101: Epigenetics and Editing the Epigenome
TypeBlog Post...-dCas9-p300 Core, as well as pLV-dCas9-p300-P2A-PuroR for lentiviral expression. Figure 1: dCas9... deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation in mammalian cells... cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells. Grant Challen... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...marker such as puromycin, you can (also) select for the positive colonies by puromycin selection. You ...transfected cells (for example, plasmid with a puromycin resistance cassette, such as PX459). After you... -
Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2
TypeBlog Post...stably integrate a reporter gene that contains a puromycin resistance gene followed by the target site (the...genome edit: A donor plasmid that contains a puromycin resistance gene linked to an in-frame H2B-GFP.... -
Plasmids 101: Shuttle Vectors
TypeBlog Post...shared by bacteria and eukaryotes. For example, puromycin inhibits protein synthesis across kingdoms by ...targeting a shared aspect of ribosomal function. A puromycin resistance gene on your vector can protect both... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...the genome. In this work, they use AAVS1_Puro_PGK1_3xFLAG_Twin_Strep and nuclease driven recombination ... -
Sleeping Beauty Awakens for Genome Engineering
TypeBlog Post...different selection markers (blasticidin, neomycin, puromycin, hygromycin) and fluorescent protein reporters... -
Hot Plasmids and Viral Preps - September 2021
TypeBlog Post...CD90.1 selection marker, Thy1.1, in addition to puromycin resistance. The MYC-CRISPR library targets E-... -
Visualizing Translation at the Single Molecule Level
TypeBlog Post...Using translation inhibitors cycloheximide and puromycin, Halstead et al. verified that translation is ... -
Plasmids 101: Mammalian Vectors
TypeBlog Post...80S; inhibits chain elongation. 50-500 ug/mL Puromycin pac HeLa, 293HEK, Jurkat T cells Inhibits protein... -
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post...lentiviral backbones expressing blasticidin or puromycin resistance genes. It’s that simple! Good luck...