Skip to main content

We narrowed to 52 results for: snap-tag

Showing: 21 - 40 of 52 results
  1. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...identify as one.  But some time around 10th grade, I snapped out of the phase of my life that had me listening...the first place? Let’s think about some of the advantages of team-based work: Nobody knows everything anymore...
  2. Lentivirus Production

    Type
    Protocol
    ...°C for several hours but should be aliquoted and snap frozen in liquid nitrogen and stored at -80 °C as...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Low serum medium such as Opti-MEM...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots...transfection to determine what ratio gives the highest percentage of GFP positive cells. Refer to the table below...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Shelkovnikova 237551 Untagged TDP-43 TARDBP CMV Alzheimer's, ALS Tatyana Shelkovnikova 237552 SNAP-tag TDP-43 TARDBP...plasmid type, mutations, and/or tags such as fluorescent protein (FP) tags. Information on genes and associated...MBP, TEV, SNAP PH ALS Anthony Hyman 221886 TH0994-pOCC177-Fus-wt_(1-211) FUS His, MBP, TEV, SNAP PH ALS ... TEV, SNAP PH ALS Anthony Hyman 221888 TH1149-pOCC177-FUS(Nhe)-RGG_RtoK FUS His, MBP, TEV, SNAP PH ALS... acceptor peptide tag polH Parkinson's Cheryl Arrowsmith 210986 pHTN-HaloTag_C9orf72:1-481 C9orf72 Halo...Mutant Partial Sequence Codon-Optimized gRNA Other Tags GFP FP other Flag GST His TEV Other, non-FP Plasmid...polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI 1177 p416 25Q GPD HTT GFP GPD...
  4. Avoiding the Dark Side of Fluorescent Protein Fusions with mOX FPs

    Type
    Blog Post
    ...and gram negative bacteria periplasm. Efforts to tag endogenous genes for proteins in these compartments...Munro, Sean, and H. R. Pelham. "Use of peptide tagging to detect proteins expressed from cloned genes:...Avaliable at Addgene Read Our Blog Post on Protein Tags Read Other Posts on Fluorescent Proteins Browse ...our guest bloggers Erik L. Snapp and Lindsey M. Costantini! Erik Lee Snapp received his PhD in Molecular... post was contributed by guest bloggers Erik L. Snapp and Lindsey M. Costantini. "You underestimate the...FP-fusion proteins functionally relative to the untagged protein of interest. To avoid the accumulation...research was conducted in the laboratory of Erik Lee Snapp and focused on optimizing fluorescent proteins for...
  5. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...categories of biosensors or browse all the biosensors tagged in our catalog . Use the article links to find ...2023.07.18.549527 Eric Schreiter Calcium GCEPIA1-SNAP ER for sensing ER calcium A genetically encoded ...by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy. 2007;3(5):452-60. Tamotsu Yoshimori...Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent Protein-Tagged Human LC3 for the Monitoring of Mammalian Autophagy...Hoffman Voltage JEDI-2P voltage indicator for two-photon imaging Sustained deep-tissue voltage recording...Rafael Yuste Voltage Ultrafast fluorescent voltage sensor ASAP2f Subcellular Imaging of Voltage and Calcium...fluorescent voltage sensor. Nat Neurosci. 2014 Apr 22. Michael Lin Voltage Fluorescent voltage reporters...
  6. Exploring Applications of the Bioluminescent HiBiT Tag

    Type
    Blog Post
    ...HiBiT tagging technology.   The bioluminescence advantage There are countless protein tags floating...the native function of tagged proteins and facilitates precise CRISPR-based tagging, or low-levels of ectopic...HiBiT tag to provide complementary validation of protein expression and localization. HiBiT-tagged targets...true biology. Fluorescent fusions utilizing bulky tags can disrupt normal cell biology and make it hard... (Tsien, 1998). What sets HiBiT apart from these tags is its use of bioluminescence to reflect protein...whether the authors incorporated HiBiT by CRISPR tagging at the endogenous locus or used other expression...responses (Kamio et al., 2025). They designed HiBiT-tagged TP53 constructs, one with an R175H mutation to ...
  7. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

    Type
    Blog Post
    ... Replace the biotinalatable tag on dCas9 with a BioTAP-tag. The BioTAP-tag is a 69 aa long biotinylation... lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP tag, and 2) gRNAs Number of loci targeted...normally expressed in eukaryotic cells. Using this tag reduces the number of CAPTURE components that need...from three to two. Lentiviral delivery of BioTAP-tagged dCas9 and gRNAs. Using lentiviral delivery of the...system Stable cell line expressing 1) FLAG-biotin-tagged dCas9, 2) BirA, and 3) one or more gRNAs Two separate...et al., 2018). Think of 3C methods as taking a snapshot of chromatin looping with the photo “developed...
  8. When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells

    Type
    Blog Post
    ...solution or something in between, you are using a tag with a serious drawback. The standard EGFP plasmid... of a POI. As an investigator, you want a fusion tag to be inert, to not produce artifacts in your experiments...Many thanks to our guest blogger Erik L. Snapp! Erik Lee Snapp received his PhD in Molecular Microbiology...This post was contributed by guest blogger Erik L. Snapp. Stop using EGFP/GFP for fusion proteins! Despite...oligomers such as DsRed or high affinity FPs such as TagRFP. Problem 3 can be solved, in most cases, by using...distance runner, gardner, and cook.   References 1. Snapp, E.L., et al., Formation of stacked ER cisternae... Resources on the Addgene Blog Read Professor Snapp's Post on mOX FPs Find the Best Fluorescent Protein...
  9. A Look at Addgene's QC Process

    Type
    Blog Post
    ...plasmid they ordered contains the correct inserts, tags, promoters, and other critical functional components...on the information provided and vector type  Any tags, selectable markers, and fusion proteins listed ...deposited sequence(s) in SnapGene. SnapGene annotates the plasmid maps based on SnapGene’s “Common Feature” library...
  10. Plasmids 101: Gibson Assembly and Other Long-Homology Based Cloning Methods

    Type
    Blog Post
    ...into a vector with a large tag at the N-terminus, but you don’t have the tag already included in the vector...you can insert both the gene of interest and the tag sequences into the vector in one step without scars...In this blog post, I will go over some advantages, disadvantages, and examples of how scientists are using... common, and for good reason. They offer many advantages over the traditional restriction enzyme cloning...thereof) nor a serious time commitment. Another advantage is that this process makes it easy to generate...primer melting temperature greater than 48℃. Both Snapgene and NEB have tools that help you design primers...video gives a helpful demonstration of how to use Snapgene’s program to design primers for Gibson Assembly...
  11. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ... cells. Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable...breeze. Modular by design: Key elements (promoter, tag, polyA site) are flanked by unique restriction sites...plasmid set, our bacterial plasmid set for expressing tagged proteins, and stay tuned for mammalian expression...streptavidin immunoprecipitation (IP), and tandem mass tag (TMT) mass spectrometry (MS) in HCT116 cells (colorectal...with tools like mass spectrometry, providing a snapshot of interacting proteins at a certain time and ...and scale bar are indicated. B) Specificity, as percentage of BiPVe3-dTomato and PV-positive cells out of...
  12. Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

    Type
    Blog Post
    ...plasmid.     Confirming tags and fusion proteins Finally, we confirm promoters, tags, fusion proteins, and...aligning to NCBI entry or using BLAST.   Confirming tags and fusion proteins. We’ll break down each of these...selectable markers by detecting common features using Snapgene. If we find information that differs from what...
  13. Simplify Cloning with in vivo Assembly

    Type
    Blog Post
    ...short sequences of up to 100 bp, such as epitope tags, design primers with template binding regions to...combining multiple primers, a C-terminal epitope tag can be moved to the N-terminus of a protein-coding... can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications requires... to the 5’ end of the reverse primer. Mutagenesis - Mutagenesis is performed by designing primers astride...modification, from insertions, deletions, and point mutagenesis to complex assembly of multiple genes. Primer...a sequence manager A sequence manager, such as SnapGene, can be very helpful to confirm primer design....rapid method for recombination and site-specific mutagenesis by placing homologous ends on DNA using polymerase...
  14. Tips for Using BLAST to Verify Plasmids

    Type
    Blog Post
    ...to an epitope tag or fusion protein. If your sequencing primer was chosen to confirm a tag or fusion protein...expected ORFs, mutations or truncations. A primary advantage of blastx is that you do not have to decide on...recommend using blastp over blastx. The primary advantage is time savings but an added benefit is that blastp...other matrices to see if another would be more advantageous for your search. Timesaving Tip #3: Note that...at NGS Plasmid Quality Control Learn about our Snapgene-powered plasmid maps. Resources on Addgene.org...
  15. CRISPR Guide

    Type
    Collection
    ...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system — co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...Plasmids: Double-Strand Break (Cut) , Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification...
  16. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ... Pages. Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do...that can open .ab1 files, such as 4Peaks (Mac), SnapGene Viewer (Mac/PC), FinchTV (Mac/PC), Sequence Scanner...
  17. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...early) Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Endosomes (early) Rab5a TagBFP James Johnson...Harrison 79806 pTag-RFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc... Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Endosomes (recycling) Rab4a TagRFP James Johnson...early) Rab5 TagBFP Gia Voeltz 61802 GFP-Rab5B Endosomes (early) Rab5B AcGFP Gia Voeltz 79802 pTag-RFP-C-h-...EEA1 EGFP Silvia Corvera 42635 TagRFP-T-EEA1 Endosomes (early) EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2...moxGFP Erik Snapp 68126 ERoxBFP Endoplasmic reticulum ER retention signal oxBFP Erik Snapp 49150 BFP-KDEL... Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Endosomes (recycling) Rab4a TagBFP James Johnson 231781 pCMV-mGold2t-Rab4a-C...
  18. Sequencing Primers

    Type
    Guide
    ...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...
  19. Trimmer Lab NeuroMab Collection

    Type
    Collection
    .../9R] ZIP3 Mouse Mouse IgG2a 206600 Anti-S-tag [N56/9R] S-tag Bovine Mouse IgG2a 206601 Anti-TrpC4 [N77...channel Mouse Mouse IgG2a 140071 Anti-Snapin/SNAPAP [L8/15R] Snapin/SNAPAP Human Mouse IgG2a 140072 Anti-Mitofusin... Human Mouse IgG2a 114476 Anti-Synaptotagmin-3 [N278/19R] Synaptotagmin-3 Mouse Mouse IgG2a 114477 Anti-TRPML3... Human Mouse IgG2a 114482 Anti-Synaptotagmin-12 [N277/7R] Synaptotagmin-12 Mouse Mouse IgG2a 114483 Anti-GluA1...) Rat Mouse IgG2a 114558 Anti-Synaptotagmin-10 [N269/73R] Synaptotagmin-10 Mouse Mouse IgG2a 114559 Anti-Ataxin... Mouse Mouse IgG2a 177526 Anti-Synaptotagmin-7 [N275/14R] Synaptotagmin-7 Mouse Mouse IgG2a 177527 Anti-Lgi1... Human Mouse IgG2a 188216 Anti-Synaptotagmin-6 [N270/47R] Synaptotagmin-6 Mouse Mouse IgG2a 188217 Anti-CASK...
  20. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ... Many thanks to our guest blogger, Erik Snapp! Erik Lee Snapp received his PhD in Molecular Microbiology...This post was contributed by Erik Snapp, the Director of Student and Postdoctoral Programs at the Janelia...Growth of new livers in culture could resolve this shortage." What is the knowledge gap you plan to address...
Showing: 21 - 40 of 52 results