We narrowed to 37 results for: t7
-
TypeCollection...101137 pSNAP-tag (T7) Vector SNAP-tag Empty backbone for bacterial expression under T7 control 101135 pSNAP-tag...
-
Hot Plasmids - August 2020
TypeBlog Post...The pMAK461-64 plasmids were expressed in SHuffle T7 Express competent E.coli (NEB) using IPTG induction... -
CRISPR Antimicrobials
TypeBlog Post... synthetic phages, each based on the well-studied T7 phage, to target various types of bacteria. In mixed... -
Depositor Collections
TypeCollection...MORF) Collection Synthetic Biology Voigt Fragmented T7 RNAP Plasmids Repressor Plasmids Sigma (σ) Factor... -
Luciferase Plasmid Collection
TypeCollection...firefly luciferase James Wilson 101156 T7-CMVtrans-FFLuc-polyA Firefly T7 Expression of firefly luciferase ...luciferase. Renilla luciferase is expressed from a T7 promoter for normalization. John Atkins 174050 pGWB-nLUC... -
Finding nucleic acids with SHERLOCK and DETECTR
TypeBlog Post...transcriptase (RT)-RPA, respectively. RPA is coupled with T7 transcription to convert amplified DNA to RNA for... -
CRISPR Plasmids - Xenopus
TypeCollection...pyogenes (PAM = NGG) 51306 pUC57-Simple-gRNA backbone T7 BsaI In vitro transcription none, need Cas9 plasmid... -
Bacterial Expression Systems
TypeCollection...(aTc) Escherichia coli Stanley Qi 11518 pDest-527 T7-lacO Lactose/IPTG Escherichia coli Dominic Esposito...Escherichia coli Cheryl Arrowsmith 26094 pET28a-LIC T7-lacO Lactose/IPTG Escherichia coli Cheryl Arrowsmith...Escherichia coli Andreas Moeglich 26092 pET15-MHL T7-lacO Lactose/IPTG Escherichia coli Cheryl Arrowsmith... -
Plasmids 101: Repressible Promoters
TypeBlog Post...be produced. Many commonly-used promoters, such as T7, CMV, EF1A, and SV40, are always active and thus ... -
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...DNA into E. coli BL21 (DE3) cells (these have the T7 polymerase and a few proteases knocked out making... -
Sequencing Primers
TypeGuide...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ... -
Promoters
TypeGuide...Expression Description T7 Constitutive Promoter from T7 bacteriophage; requires T7 RNA polymerase Sp6 Constitutive... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Tetracycline (Tet) Inducible Expression page Bacteria Lac, T7, araBAD, trp mTagBFP2-pBAD - Protein expression vector... -
Modular Cloning Guide
TypeGuide...Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic terminators... -
27 Hot Plasmids from 2016
TypeBlog Post...Grunwald pCS2TAL3-DD, pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...yes, cut S. pyogenes W Fujii MSP1673 65769 Bacteria T7 yes, cut N. meningitidis Joung Cas9 sgRNA vector ... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial Expression CLIP-Tag Benzylcytosine...