We narrowed to 844 results for: tat

...longer requires the viral transactivator, Tat. For more information on the different generations of lentiviral...promoter of the 5’ long terminal repeat (LTR) is mutated in third generation systems such that it no longer...spin columns, and polyethylene glycol (PEG) precipitation. All of these methods ultimately isolate the...downstream applications. For example, while the PEG precipitation method is relatively inexpensive and does not...not require an ultracentrifuge, PEG will precipitate all proteins in a solution, not just the lentivirus...

...- Renaturing Solution (Potassium Acetate) 120 mL 5M Potassium acetate 23 mL glacial acetic acid 57 mL ...isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification...down causing the proteins and genomic DNA to precipitate, while leaving the smaller plasmids free in solution...supernatant. Add either ethanol or isopropanol to precipitate the plasmid DNA. Either spin to pellet the DNA... solution to a column that will bind the now precipitated DNA. Wash the pellet or column with 70% ethanol...tube. Mix by inverting several times. A white precipitate will be formed which contains the bacterial proteins...room temperature isopropanol to the solution to precipitate the plasmid DNA; see detailed protocol below ...

...Isopropanol (for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B)...Glycogen may be used as a carrier to facilitate RNA precipitation. This does not affect the quality of...lysis of cells or tissues, extraction of RNA, precipitation, and resuspension. This protocol provides two...thiocyanate-phenol solution such as TRIzol®. For the precipitation step, two options are also included: using Isopropanol...Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol...sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL...

...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP...co-incubate it with an “assist peptide” that facilitates endosomal escape. Combining Cas9-PAGE with lentiviral...Balasubramanian and colleagues showed the single mutation E138D is sufficient to disrupt dimerization while...

...into a backbone vector of choice with minimal limitations. Background In its simplest form, PCR based cloning.... Remember to insert your DNA in the correct orientation in the recipient plasmid by viewing the MCS and...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...

...verification of the orientation so long as the expected products from each orientation are different sizes...digest to verify plasmid size, verify insert orientation, and more. Protocols...you have the correct plasmid. Verifying Insert Orientation by Restriction Digest If you clone an insert ... verify that it has be cloned in the correct orientation - this can be done by restriction digest. Although...have to do so, there is no way to control which orientation the insert is ligated into the vector backbone...clone(s) in which the insert is in the correct orientation. In the example below we want to know how to ... between two clones that differ only in the orientation of the insert. By choosing an enzyme (or enzymes...

...Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...

...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG...tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration...CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloning vector...assay: Assay Days post-infection mRNA knockdown (quantitative PCR) ≥3 days Protein knockdown (western blot...

...restriction sites that are also present in the same orientation on your target vector. If you are not sure what...Will result in your insert being in the correct orientation in the recipient plasmid. (You don't want to ...verify that the insert was cloned in the correct orientation. If you cannot find enzymes that meet these criteria...flank your insert and will result in correct orientation in the recipient plasmid, it is useful to see...compatible overhangs you will need to verify the orientation of your insert, so you may want to design a diagnostic...

...instructions if you are unsure of the correct orientation of the gel. Carefully remove the comb from the...gel with deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the...SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue...deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the...

...mismatch/mutation may be the result of a mis-called peak in the trace file. If the mutation is not an...such as the gene/insert, fusion proteins, point mutations, deletions, etc.) involves selecting one or more...Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do not sequence...

...and plasmid recombination can all impact the representation of individual plasmids in the pooled library...individual libraries may require modifications dictated by the originating laboratory for optimal results...adequate NGS based QC to ensure no change in representation compared to the pre-amplified stock. A last...note that NGS should be performed to ensure representation is maintained. Maxipreps - Less is more: Do...

...by a ‘CAC’ codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes...Base editors create specific point mutations in the genome, but they’re inefficient compared to CRISPR... is a bicistronic construct that consists of a mutated mCherry and a downstream constitutively active ...the eGFP reporters the Harris lab individually mutated three codons in eGFP to eliminate fluorescence....eGFP reporters rely on the correction of point mutations in eGFP that results in the restoration of fluorescence...GFP construct, that contains an ACG start codon mutation, and integrated it into human and mouse cells ...events in vivo. As GO relies on the correction of a mutated start codon to initiate protein expression, it ...

...caused from loss-of-function mutations in the MECP2 gene. Causative mutations for Rett syndrome typically...within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor ...missense mutations located in the MBD, and truncations prior to the NID are more severe than mutations further...to their laboratory website. Cell Line Mutation (DNA) Mutation (protein) Sex Source of Material Publication...species (mouse or human) Mutation ID Plasmid Description Gene/Insert Mutations PI Return to top External...meet diagnostic criteria have disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2...erminal D omain (CTD) The most common missense mutations cluster in the MBD and NID demonstrating the importance...

...Barros Lactate/Pyruvate Lapronic FRET-based sensor for Lactate/Pyruvate Ratio Imaging of the Lactate/Pyruvate...(4):525-531.e4. Dmytro Yushchenko Lactate Laconic FRET-based lactate sensor Barros Lab Laconic Plasmids...Felipe Barros Lactate Expresses eLACCO1.1 fluorescent biosensor for extracellular L-lactate, in neurons,...extracellular L-lactate. Nat Commun. 2021 Dec 6;12(1):7058. Marie-Eve Paquet , Robert Campbell Lactate Lindoblum... fluorescent biosensor for lactate Green fluorescent protein-based lactate and pyruvate indicators suitable... cytosolic NADH/NAD+ redox state Imaging Cytosolic NADH-NAD(+) Redox State with a Genetically Encoded ...Oct 23;9(10):e110600. Isei Tanida Electrostatic potential Quantitative measurements of membrane charges...

...recombinase-dependent: Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items...Collection INTRSECT Plasmid Collection INTRSECT Implementation Plasmids References The development of powerful...producing a functional molecular tool (C,F). Implementation The following resources may be of interest ...developed, including additional fluorophores, excitatory and inhibitory opsins , genetically-encoded calcium...Recombinases Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55636 pAAV-EF1a-Cre None ...-dependent Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55641 pAAV-Ef1a-fDIO EYFP...Fluorophores Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55650 pAAV-hSyn Con/Fon EYFP...

...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...

..., deletion, or translocation) depends on the orientation of each target site (see Figure 1). Figure 1:...Recombination outcomes are determined by target site orientation. A) If the target sites (loxP) are on the same...(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer... lox511, loxN, lox66/lox71 Dre rox TAACTTTAAATAATgccaATTATTTAAAGTTA 14 bp inverted repeats + 4 bp spacer...site is widely used. Flp FRT GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8... F3, F5, FRT14, FRT15 minimal FRT GAAGTTCCTATTCtctagaaaGTATAGGAACTTC Table 1. Summary of Cre, Dre, and... example, iCre or FLPo in mammalian cells may facilitate higher rates of recombination. Gene Expression...

...contain the A206K mutation are monomeric at all concentrations, so this is mutation is noted when present...Photoactivatable (Off to On) Excitation and Emission wavelengths after activation. Protein Excitation (nm) Emission ...maximal value. Structure describes the oligomeric state of the protein. Many FPs are monomers at low concentration...vector type, popularity, and more. Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Return to top Cyan Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Return to top Green Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Mammalian Expression Return to top Yellow Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...

...71. PMID: 19066593 Other citations include: Bogner, et al. 2015. Capsid Mutated Adeno-Associated Virus ...References for each serotype can be found below under Citations. AAV2(Y444F) The AAV2(Y444F) serotype is demonstrated...from the AAV2 capsid and contains the following mutations: Y444F, Y500F, and Y730F. AAV2(4pMut)dHS The AAV2...It is derived from AAV2 and has the following mutations: Y444F, Y500F, Y730F, T491V, R487G, R585S, and...from the AAV6 capsid and contains the following mutations: Y705F, Y731F and T492V. AAV44.9 The AAV44.9 serotype...Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F) When using the AAV2(Y444F...Ther . Feb;19(2):293-301. PMID: 21045809 Other citations include: Chen, et al. 2014. Reprogramming adipose...