We narrowed to 846 results for: tat
-
TypeBlog Post...longer requires the viral transactivator, Tat. For more information on the different generations of lentiviral...promoter of the 5’ long terminal repeat (LTR) is mutated in third generation systems such that it no longer...spin columns, and polyethylene glycol (PEG) precipitation. All of these methods ultimately isolate the...downstream applications. For example, while the PEG precipitation method is relatively inexpensive and does not...not require an ultracentrifuge, PEG will precipitate all proteins in a solution, not just the lentivirus...
-
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...- Renaturing Solution (Potassium Acetate) 120 mL 5M Potassium acetate 23 mL glacial acetic acid 57 mL ...isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification...down causing the proteins and genomic DNA to precipitate, while leaving the smaller plasmids free in solution...supernatant. Add either ethanol or isopropanol to precipitate the plasmid DNA. Either spin to pellet the DNA... solution to a column that will bind the now precipitated DNA. Wash the pellet or column with 70% ethanol...tube. Mix by inverting several times. A white precipitate will be formed which contains the bacterial proteins...room temperature isopropanol to the solution to precipitate the plasmid DNA; see detailed protocol below ... -
Kit Free RNA Extraction
TypeProtocol...Isopropanol (for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B)...Glycogen may be used as a carrier to facilitate RNA precipitation. This does not affect the quality of...lysis of cells or tissues, extraction of RNA, precipitation, and resuspension. This protocol provides two...thiocyanate-phenol solution such as TRIzol®. For the precipitation step, two options are also included: using Isopropanol...Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol...sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL... -
Hot Plasmids February 2024
TypeBlog Post...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP...co-incubate it with an “assist peptide” that facilitates endosomal escape. Combining Cas9-PAGE with lentiviral...Balasubramanian and colleagues showed the single mutation E138D is sufficient to disrupt dimerization while... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...into a backbone vector of choice with minimal limitations. Background In its simplest form, PCR based cloning.... Remember to insert your DNA in the correct orientation in the recipient plasmid by viewing the MCS and...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to... -
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...verification of the orientation so long as the expected products from each orientation are different sizes...digest to verify plasmid size, verify insert orientation, and more. Protocols...you have the correct plasmid. Verifying Insert Orientation by Restriction Digest If you clone an insert ... verify that it has be cloned in the correct orientation - this can be done by restriction digest. Although...have to do so, there is no way to control which orientation the insert is ligated into the vector backbone...clone(s) in which the insert is in the correct orientation. In the example below we want to know how to ... between two clones that differ only in the orientation of the insert. By choosing an enzyme (or enzymes... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol...Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG...tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration...CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloning vector...assay: Assay Days post-infection mRNA knockdown (quantitative PCR) ≥3 days Protein knockdown (western blot... -
Plasmid Cloning by Restriction Enzyme Digest (with Protocols)
TypeProtocol...restriction sites that are also present in the same orientation on your target vector. If you are not sure what...Will result in your insert being in the correct orientation in the recipient plasmid. (You don't want to ...verify that the insert was cloned in the correct orientation. If you cannot find enzymes that meet these criteria...flank your insert and will result in correct orientation in the recipient plasmid, it is useful to see...compatible overhangs you will need to verify the orientation of your insert, so you may want to design a diagnostic... -
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...instructions if you are unsure of the correct orientation of the gel. Carefully remove the comb from the...gel with deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the...SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue...deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...mismatch/mutation may be the result of a mis-called peak in the trace file. If the mutation is not an...such as the gene/insert, fusion proteins, point mutations, deletions, etc.) involves selecting one or more...Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do not sequence... -
Four Base Editing Reporters to Monitor and Enrich Editing in Real-time
TypeBlog Post...by a ‘CAC’ codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes...Base editors create specific point mutations in the genome, but they’re inefficient compared to CRISPR... is a bicistronic construct that consists of a mutated mCherry and a downstream constitutively active ...the eGFP reporters the Harris lab individually mutated three codons in eGFP to eliminate fluorescence....eGFP reporters rely on the correction of point mutations in eGFP that results in the restoration of fluorescence...GFP construct, that contains an ACG start codon mutation, and integrated it into human and mouse cells ...events in vivo. As GO relies on the correction of a mutated start codon to initiate protein expression, it ... -
CRISPR Library Amplification
TypeProtocol...and plasmid recombination can all impact the representation of individual plasmids in the pooled library...individual libraries may require modifications dictated by the originating laboratory for optimal results...adequate NGS based QC to ensure no change in representation compared to the pre-amplified stock. A last...note that NGS should be performed to ensure representation is maintained. Maxipreps - Less is more: Do... -
Viral Vectors 101: Integrase-Deficient Lentiviral Vectors
TypeBlog Post...The packaging plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here, the Pol...by long terminal repeat (LTR) sequences, which facilitate integration of this portion into the host genome...vesicular stomatitis virus G protein (VSV-G), which facilitates viral entry into the host cell. Transfecting...(see Figure 2). Figure 2: Schematic representation of integration process and episomal forms of...Addgene: psPAX2-D64V. This construct has the D64V mutation, a single amino acid change (from aspartic acid...detecting vector particle components or performing quantitative PCR titration of vector DNA in samples harvested...Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of... -
Centrifugation
TypeProtocol...that can hold larger containers, but they can also rotate at much higher speeds and are used for more specialized...balanced. Using the centrifuge in an unbalanced state can damage the centrifuge and be dangerous for the... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol...contact with hazardous materials. A sink, eyewash station, safety shower, fire blanket, and extinguisher ... are located before you start. Use the eyewash station if unwanted or biohazardous materials are splashed... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol...that the insert will be added in the correct orientation and prevents the vector from ligating to itself...indicates the various controls: Control Ligase Interpretation Uncut vector - Checks viability of competent... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGCAGAGGCTAAAGCGTTcgctgtccttcaagacCAAGAGTCTTCGCAGCAA Stat3 TAL3560 & TAL3561 TGCAGCAGTTGGAGACGCggtatctggagcagctGTATCACCTGTACAGCGA stxbp1a TAL3562...engineered TALENs can be used to induce targeted mutations with high efficiency in zebrafish ( Sander et ...TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA...TCAGCTCCCCGGAGAGGCaccgcactgctccagggTTGGATGATGGACATGGA bsx TAL3034 & TAL3035 TCTCAGACTCACAGTTATccggactcgagaaaagGTTCGAGATCCAGAGATA btr30 TAL3036 & TAL3037 ...casp8ap2 TAL3038 & TAL3039 TATAACAAATCCCACCACattgcccgatatcttgAATACTTCCAAAACAAAA Ccl2 TAL3222 & TAL3223 TTTTCGTTTTCCACTATAaagatcccagttaagcAGGTTCAGAGTTATCATA... TTTTCGTTTTCCACTATAaagatcccagttaagcAGGTTCAGAGTTATCATA cebpa TAL3040 & TAL3041 TATTCCACAACAGCTCCAagcaagagaagctcaaACTGGCGAGCGGAGACTA...TTCTCAAAATGAGAGGGGtgaatctgaagttcaaCAAACCCAGCAGCACCAA CIT1 TAL3226 & TAL3227 TGAAGTTTAAATATGGAGgtcatggcagtgttaaAGATCTGTCCGCAGTCGA cited2 TAL3228 & TAL3229... -
Validated gRNA Sequences
TypeCollection...Addgene's Datatable of validated gRNA sequences....validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database...designed to accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid...pyogenes 25739462 Jiang ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui...Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG... TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes...25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ... -
Pouring LB Agar Plates
TypeProtocol...autoclave, you should prepare your plate pouring station: Find an empty section of lab bench with a working...thermometer. Light the flame at the plate pouring station and dilute your antibiotic into your ~60 ℃ molten...