We narrowed to 30 results for: ubiquitin
-
TypeCollection...pyogenes Hyg Chen 86196 pYPQ141-ZmUbi-RZ-As Maize ubiquitin 1 none As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes...
-
Genetic Code Expansion
TypeCollection...sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP... RF1 function removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 ... -
Luciferase Plasmid Collection
TypeCollection...expression of firefly luciferase from the Zea mays ubiquitin promoter. Paul Schulze-Lefert 83282 pAAV-CAG-RLuc... -
Sequencing Primers
TypeGuide...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... -
CRISPR Pooled gRNA Libraries
TypeCollection...Human Ebert 3rd 4 2,852 Bonifacino Lab Human ubiquitination-related proteins CRISPR KO library 174592 Knockout... -
Modular Cloning Guide
TypeGuide...Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms in E. coli ... -
27 Hot Plasmids from 2016
TypeBlog Post...AID tag could be targeted for degredation via ubiquitination. The key feature of auxin-induced degredation... -
Fluorescent Protein Guide: Biosensors
TypeCollection...retroviral expression of pH sensitive mt-mKeima) The ubiquitin kinase PINK1 recruits autophagy receptors to induce... -
Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy
TypeBlog Post...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and... -
Immunology Research Plasmids and Resources
TypeCollection...associated protein C20orf188, TRRP4AP, TRUSS UBR1 ubiquitin protein ligase E3 component n-recognin 1 JBS, ...