We narrowed to 30 results for: ubiquitin

...cauliflower mosaic virus 35S promoter (CaMV 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene carries...

...sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP... RF1 function removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 ...

...expression of firefly luciferase from the Zea mays ubiquitin promoter. Paul Schulze-Lefert 83282 pAAV-CAG-RLuc...

...retroviral expression of pH sensitive mt-mKeima) The ubiquitin kinase PINK1 recruits autophagy receptors to induce... monitor cell physiology FUCCI: fluorescent ubiquitination-based cell cycle indicators RNA-based aptamer...

...Constitutive Plant High-expression promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter...

... Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...

...Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms in E. coli ...

...AID tag could be targeted for degredation via ubiquitination. The key feature of auxin-induced degredation...

...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and...

...associated protein C20orf188, TRRP4AP, TRUSS UBR1 ubiquitin protein ligase E3 component n-recognin 1 JBS, ...