We narrowed to 32 results for: ubiquitin plasmid

...Localization , Optogenetics Plasmids , and Chemogenetics Plasmids . Find plasmids for endogenous gene tagging... and plasmid collections that may help with your neurodegeneration research. Disease Info Plasmid Collection...Research Tools Neurodegeneration Plasmid Collection A collection of plasmids expressing wild type or mutant... constructs: pLVX-UbC-rtTA-Ngn2:2A:EGFP (Schafer et al. Nat Neurosci. 2019) pLVX-UbC-rtTA-Ngn2:2A:Ascl1...more. Plasmids provided by the foundation can be found on our Michael J. Fox Foundation Plasmid Resource...genes linked to neurodegenerative disorders. Find plasmids expressing HTT, C9ORF72, LRRK2, Synuclein, and... Dev Cell. 2024) Image exocytosis with VAMP2/3 plasmids to study CNS myelination. (Lam et al. Nat Commun...

...a specific tissue. XFPs are introduced using a plasmid construct called Zebrabow-GateDest containing an...YFP. After crossing onto a tamoxifen-inducible ubiquitin background, each cell in the mouse that expresses...introduced in vivo either by electroporation of plasmids, or using AAV vectors. The Imai lab also developed...

...cite the original paper but link to plasmids from the Promega Plasmid Collection that express similar constructs...Addgene Luciferase 101 Luciferase Plasmid Collection Promega Plasmid Collection ...The authors investigated the role of cytosolic ubiquitin ligases in the degradation of CFTR, specifically...cell and protein analysis products. You can find plasmids deposited by Promega scientists here.  References...

... 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene carries Cas9-containing plasmids for knockout... consists of a Ti plasmid, into which the GOI is inserted, and a Ti "helper" plasmid, which contains Vir...for creating plant expression plasmids, including plant CRISPR plasmids from the Yiping Qi lab and the...plant-specific modifications to commonly used CRISPR plasmids are necessary to use the CRISPR system in plant...expression of both Cas9 and the gRNA off of the same plasmid. Delivering CRISPR components to plant cells Once...and insertion into the plant genome. B) The Ti plasmid and helper are transformed into agrobacterium tumefaciens...and exposed to plant cells. The region of the Ti plasmid between the T-DNA borders (yellow) are recognized...

...You’ve gotten the plasmid encoding your protein of interest from Addgene, transfected it into your target...from a variety of vendors and you may even find plasmids encoding antibodies from Addgene that you can ...phosphorylation, acetylation, methylation and ubiquitination. For example, to test if a protein is phosphorylated...

...Find GCE synthetase plasmids, target plasmids, and bacterial strains useful for expanding the genetic... Plasmid Collections Genetic Code Expansion Genetic Code Expansion Synthetase Plasmids Target Plasmids...achieve these modifications, two plasmids are generally used. Once these plasmids have been introduced in the... ncAAs. This plasmid often carries multiple tRNA copies for efficiency. A target plasmid containing the...NIH-funded GCE4All Research Center . Synthetase Plasmids Browse plasmids that contain aminoacyl-tRNA synthetases... of these plasmids also contain one or multiple copies of the cognate tRNA gene. ID Plasmid Synthetase...Bacterial TAG Wei Niu Return to top Target Plasmids Browse plasmids that contain genes with modified codons...

...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid's page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...

...Promoters Mammalian shRNA Plasmids Cre-lox Plasmids Stem Cell Research Plasmids References Das, A. T., Tenenbaum.... ID Plasmid Description Transactivator Promoter PI 21915 Tet-pLKO-puro Lentiviral Tet-On plasmid for ...with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...search our collection for all dox-regulated plasmids . ID Plasmid Description PI 63800 PB-TRE-dCas9-VPR Tet-inducible...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...expression and find plasmids for your experiments using tet- or dox-inducible systems. Plasmid... Plasmid Collections Tetracycline...

... Optogenetics Plasmids Viral Service: AAV Biosensors Luciferase Plasmids Promega Plasmid Collection Explore...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids encoding fluorescent biosensors to measure biomolecules or genes via FRET or other assays... Plasmid Collections Fluorescent Proteins Fluorescent Biosensors Fluorescent Proteins: Biosensors...our catalog . Use the article links to find the plasmids associated with the article. We also offer ready-to-use...ready-to-use AAV preparations of select plasmids and AAV Packaged on Request for many more. Metal Ions ...C-terminal domain of troponin C Griesbeck Lab Twitch Plasmids Oliver Griesbeck Calcium erGAP3 (GFP-Aequorin ...

...Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters Plasmids 101: Repressible...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last...often incorporate the following promoters into plasmids to drive constitutive or inducible expression....Constitutive Plant High-expression promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter...

...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...

... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Fluorescent Proteins Cancer Research Plasmids Gene Categories Plasmid Tables Additional Resources Mammalian...to the available plasmids for each gene. Please note that not all genes have plasmids available for request...and apoptosis. Plasmid Tables The gene names in these tables link to the available plasmids for each gene...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...rapidly initiate a secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped...