We narrowed to 30 results for: ubiquitin plasmid

...You’ve gotten the plasmid encoding your protein of interest from Addgene, transfected it into your target...from a variety of vendors and you may even find plasmids encoding antibodies from Addgene that you can ...phosphorylation, acetylation, methylation and ubiquitination. For example, to test if a protein is phosphorylated...

...Find GCE synthetase plasmids, target plasmids, and bacterial strains useful for expanding the genetic... Plasmid Collections Genetic Code Expansion Genetic Code Expansion Synthetase Plasmids Target Plasmids...achieve these modifications, two plasmids are generally used. Once these plasmids have been introduced in the... ncAAs. This plasmid often carries multiple tRNA copies for efficiency. A target plasmid containing the...NIH-funded GCE4All Research Center . Synthetase Plasmids Browse plasmids that contain aminoacyl-tRNA synthetases... of these plasmids also contain one or multiple copies of the cognate tRNA gene. ID Plasmid Synthetase...Bacterial TAG Wei Niu Return to top Target Plasmids Browse plasmids that contain genes with modified codons...

...Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI ...Resources Promega Plasmid Collection Fluorescent Proteins Guide Fluorescent Biosensor Plasmids Blog: Luminescence...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid... Plasmid Collections Luciferase...

... Optogenetics Plasmids Viral Service: AAV Biosensors Luciferase Plasmids Promega Plasmid Collection Explore...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids encoding fluorescent biosensors to measure biomolecules or genes via FRET or other assays... Plasmid Collections Fluorescent Proteins Fluorescent Biosensors Fluorescent Proteins: Biosensors...our catalog . Use the article links to find the plasmids associated with the article. We also offer ready-to-use...ready-to-use AAV preparations of select plasmids and AAV Packaged on Request for many more. Metal Ions ...C-terminal domain of troponin C Griesbeck Lab Twitch Plasmids Oliver Griesbeck Calcium erGAP3 (GFP-Aequorin ...

...Neurosci 2016. PubMed PMID: 26950006 Plasmid ID Plasmid Name Plasmid Type 74309 pcDNA3.0-TRPV4-p2A-ferritin-p2A-mCherry...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These brief articles...features and applications of a partiular plasmid or set of plasmids. We hope that these articles make it ... you to find and use the plasmids you need. You can find all the hot plasmids from 2016 below. With over...over 45,000 plasmids, we can't write posts for every great plasmid that comes into the repository, but...write about your plasmids in a future blog post. No time to read? Listen to our hot plasmids segment on the...stocks in a single plate with every plasmid or as individual plasmids shipped as agar stabs. Iverson, et...

...Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters Plasmids 101: Repressible...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last...often incorporate the following promoters into plasmids to drive constitutive or inducible expression....Constitutive Plant High-expression promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter...

...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ... Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...

...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...

...because it relies on a single BiFC pair. Find BiFC plasmids for your experiment at Addgene! How to Design ...straightforward in easy-to-transfect cell lines where plasmid dosage can be tightly controlled. This is also ...Resources on Addgene.org Find fluorescent protein plasmids and resources Visit our Molecular Biology Reference...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and...

... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Fluorescent Proteins Cancer Research Plasmids Gene Categories Plasmid Tables Additional Resources Mammalian...to the available plasmids for each gene. Please note that not all genes have plasmids available for request...and apoptosis. Plasmid Tables The gene names in these tables link to the available plasmids for each gene...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...rapidly initiate a secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped...