Skip to main content
Addgene

We narrowed to 451 results for: abo.5

Showing: 381 - 400 of 451 results
  1. New CRISPR Tools: Cas7-11 and PASTE

    Type
    Blog Post
    ...;597(7878):720-725. doi: 10.1038/s41586-021-03886-5. Epub 2021 Sep 6. PMID: 34489594. Eleonora I. Ioannidi.... Eugene Koonin and Kira Makarova, longtime collaborators of Omar and Jonathan and experts in CRISPR evolution...
  2. 10 Steps to a Perfect Science Talk

    Type
    Blog Post
    ...years and a talk about your research or work will write itself when the time comes. 5. Choose interesting...interesting content Talk about something you know a lot about and that you care about. Don’t try to present ...engaging and memorable. If you read my story above about the presentation faux pas, you are more likely...the room, so it is a good idea to start thinking about public speaking early and often. Two of my jobs ...dynamite presentation?  To that end, let’s chat about giving science talks and how to make them serve ...other people give great talks We are not talking about lab meeting here. Lifeless presentation of experimental...You want to give the audience something to think about, argue with, or learn from. Some of the best talks...
  3. Transferable Skills Guide: Time Management

    Type
    Blog Post
    ... the experiment. The second way, it will take you 5 days to complete the experiment, but you’ll only spend...post useful. After a bit of research and thinking about my own processes, I’ve broken down time management...task, you’re actively prioritizing. In my anecdote above, I prioritized splitting cells over meeting up with...was too late. I didn’t spend enough time thinking about the possibilities and how to prioritize them. When...month, or even the year, you should be thinking about two main things: How useful the task is (its utility...plasmids to send to Addgene). Following my advice from above, you should probably take the second option. Even... recommend the second option for the experiment above, but it’s also important not to load yourself up...
  4. Replacing Paper: Tips for Choosing an Electronic lab Notebook

    Type
    Blog Post
    ...Resources on the Addgene Blog Learn about more tools for reproducibility 5 great apps for lab life Developing...allow you to collaborate within the platform and avoid countless emails. Important collaborative functionalities...of the software. We identified that when talking about ELN costs and limited budgets, “a large percentage...Besides that, academic institutions tend to think about the long term, so they need a solution for which...institution. In the study, respondents were also asked about how important ease of use is for them (if they are...or partners to access your data? If you are collaborating with other labs or clients, you might need share...comments, added files, notes etc. Detailed records about every action performed in the lab (user, date, time...
  5. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...naturally occurring regions in the 5’ UTR of mRNA that bind metabolites, leading to conformational changes...Spinach-based riboswitches can be used as stable metabolite sensors for imaging in live cells. By placing...placing Spinach downstream of a riboswitch, metabolite binding to the riboswitch instead activates Spinach ...Dimerization of Broccoli increases its fluorescence by about 1.8-fold, and may be a better choice for imaging...modification that reduces nonspecific binding with RNA by about 7x). Mango fluoresces nearly as brightly as Spinach...Additional resources on the Addgene blog Learn more about aptamer fluorophores Investigate other fluorescent...
  6. Twenty Years of Sharing: Addgene's Viral Vector Service

    Type
    Blog Post
    ...faster than jGCaMP7 (Figure 5B).   Figure 5: A) GCaMP6, jGCaMP7, and jGCaMP8 viral preps distributed...all, a delivery method. I would be remiss to talk about them without looking at what they’re delivering .... But in the years since, we’ve learned so much about what it takes to make these viral vectors not only...., 2016), video, educational resources, and collaborations, and will continue to do so, in the hopes that...leave a comment; or take our AAV survey. Learn more about GCaMPs and other tools developed through the GENIE...
  7. Thoughts on the Future of Research 2015 Boston Symposium

    Type
    Blog Post
    ...the life sciences end up in tenure track position 5 years after receiving their PhDs, still strive to ...compile more comprehensive demographic information about the postdoc work force, problems start with the ...by Paula Stephan is $40,000) Increase Knowledge about Postdoc and Graduate Student Career Outcomes University...through many iterations read by your PI, your collaborators, others you know in the field, and even people...important questions that still need to be answered about the makeup and welfare of the many researchers out...
  8. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the ubiquitous CAG promoter...the pX330 plasmids used in the validation assay (above) and it is just as effective (Mashiko et al., 2014...Engineering with CRISPR Validate Your Genome Edit Learn about Non Homologous End Joining and Homology Directed...
  9. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ... Biology 946 (2013). 1-13. Pubmed PMID: 23179822. 5. Segura, M.M., Kamen, A., Garnier, A. “Downstream ...Lentiviruses are a powerful laboratory tool often employed to establish cell lines that stably express...Get Tips for Titering Your Lentivirus Learn All About Viral Vector Elements Learn How to Do Genome-Wide...
  10. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...templated-repair pathways have these central steps: The 5’ DNA end of the break is resected by nucleases to ...Featured Topic Page Learn about Non-Homologous End Joining Learn about Base Editing Read 3 Tips ...
  11. An Introduction to Adenovirus

    Type
    Blog Post
    ...between 26–45 kb in length. Human adenovirus type 5 (hAdV-C5) can be considered the prototype, although...this introduction gives a sense of what AdVs are about – and we hope that it inspires further use of existing...
  12. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...Tropism of Lentiviral Vectors through Pseudotyping. CGT 5:387–398 . https://doi.org/10.2174/1566523054546224... also toxic at high concentrations as described above and is inactivated by the complement system in serum...
  13. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...191–197. https://doi.org/10.1016/0378-1119(88)90117-5  Lale, R., Brautaset, T., & Valla, S. (2011). Broad-host-range...plasmids may have high copy numbers and reduced metabolic load (Meyer 2009). Figure 1: Idealized ...
  14. Immunocytochemistry

    Type
    Protocol
    ...working solution by diluting 5 µL of the 300 µM DAPI stock solution into 5 mL PBS. Protect from light. ...coverslips HeLa cells 24-well plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino-2-phenylindole (DAPI) Bovine ... µM DAPI stock solution by diluting 2.1 µL of the 5 mg/mL DAPI solution to 100 µL PBS. Protect from light...well of a 24-well cell culture treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to... the appropriate container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Permeabilize cells ...it in an appropriate waste container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Section 3...it in an appropriate waste container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Dilute the...
  15. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2...cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response element...Forward oligo: 5’ CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—... and a 5kb fragment. 5. Sequence positive clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA...-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37°C, 5% CO 2 overnight...°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO 2 for 24... Day 5: n. Harvest media from cells and pool with media from Day 4. Spin media at 1,250 rpm for 5 minutes...
  16. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ...better. The Thomas Kilmann Conflict Model describes 5 basic approaches to conflict resolution based on various...rely on what I know about those particular teams at that given time. I think about how previous iterations...disagreements. In fact, conflict resolution isn’t just about resolving conflicts between other people, but resolving...normally get along well with each other disagree about a specific decision, direction, or goal. Resolving...of lapsed communication. Making some assumptions about how something should be communicated is necessary...confusion around... Ownership: Misunderstandings about who is responsible for what tasks or projects is...conflicts.  Transitioning a conflict into a collaboration may not be the easiest resolution to accomplish...
  17. Building Global Connections with the International Mentorship Program USA-EUROPE

    Type
    Blog Post
    ...Biomedicine to 78 undergraduate/graduate students from 5 independent universities in Spain through 22 international...USA-Europe professional collaborations, setting up bases and contacts with Spanish laboratories to start working...where individuals can exchange ideas, network, collaborate, and innovate internationally. Why an International...needs, and came from the universities mentioned above. The initial IMP cohort of 78 mentees included: ...    Other Resources Visit the IMP website Learn about the Mentor Circle Program at Brigham and Women's...Networking for Scientists Series Read our Blog Post about Choosing a Mentor      ...
  18. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo... company: Top oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG...reverse compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom...Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = 28 bp We also need to include additional bases ...oligo, making our final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom...oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (...phosphatase treat your cut vector it is necessary to use 5'-phosphorylated oligos. This is an option that can...
  19. Finding nucleic acids with SHERLOCK and DETECTR

    Type
    Blog Post
    ...however recognizes a different PAM site and generates 5’ and 3’ staggered ends after dsDNA breaks. The Doudna...Addgene Blog Learn about using toehold switches to detect Zika virus   Learn more about targeting RNA with...time-consuming, and complex to use outside of standard laboratories. In the case of the COVID-19 pandemic, qPCR ...with Cas13a (C2c2) Learn more about Cas12a (Cpf1) and its multiplex genome editing abilities Resources...
Showing: 381 - 400 of 451 results