...working solution by diluting 5 µL of the 300 µM DAPI stock solution into 5 mL PBS. Protect from light. ...coverslips HeLa cells 24-well plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino-2-phenylindole (DAPI) Bovine ... µM DAPI stock solution by diluting 2.1 µL of the 5 mg/mL DAPI solution to 100 µL PBS. Protect from light...well of a 24-well cell culture treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to... the appropriate container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Permeabilize cells ...it in an appropriate waste container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Section 3...it in an appropriate waste container. Wash 3x for 5 min in 500 µL PBS on a rocking platform. Dilute the...

...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2...cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response element...Forward oligo: 5’ CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—... and a 5kb fragment. 5. Sequence positive clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA...-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37°C, 5% CO 2 overnight...°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO 2 for 24... Day 5: n. Harvest media from cells and pool with media from Day 4. Spin media at 1,250 rpm for 5 minutes...

...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo... company: Top oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG...reverse compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom...Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = 28 bp We also need to include additional bases ...oligo, making our final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom...oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (...phosphatase treat your cut vector it is necessary to use 5'-phosphorylated oligos. This is an option that can...

...targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe...pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution plate and pipette 5–10 times ...time. Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer...400) Dilution 3 (20X): 5 µL in 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer...buffer (1:160,000) Dilution 5 (20X): 5 µL in 95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in...dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For dilutions 6–8, use...PCR tubes. Add 5 µL of dilutions 6–8 to the appropriate PCR tubes. Pipette back and forth 5 times. Lightly...

... concentration: 4 × 10 5 cells/mL To seed one 96-well plate, make 10 mL of a 5 cell/mL solution. Calculate...conditioned medium prepared above to make a new cell solution at a concentration of 5 cells/mL. Prepare approximately...high glucose, add 55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable...0.45 µm PES filter or centrifugation at >500 x g for 5 minutes. Do not use the medium if the cells are overly...this cell solution in fresh complete medium. This 5 cells/mL solution will be used to seed the 96-well...the total cells needed: Total cells needed: 10 mL × 5 cells/mL = 50 cells Determine the volume of homogenized...homogenized cell solution needed: (50 cells)/(4 × 10 5 cells/mL) = 0.125 µL Because this is such a small ...

...oligo) primers, which anneal to the regions upstream (5’) and downstream (3’) of the DNA segment to be amplified...Repeat steps 2-4 25-30 times. Final Extension for 5 minutes at 72°C: A final extension to fill-in any ... tube Ice Bucket 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM...36.8 μL Sterile dH 2 O 0.2 μL Taq DNA Polymerase (5 units/μL) PCR Machine Agarose Gel Procedure Primer...reagents on ice): 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM...Reverse Primer (10 μM stock) 0.2 μL Taq DNA Polymerase (5 units/μL) 36.8 μL Sterile dH 2 O (variable) Note: ...reaction tubes in PCR machine. Set annealing temperature 5°C below the primer melting temperature (Tm). Set extension...

...genomic DNA. Incubate tube on ice for 5 min. Centrifuge the tube for 5 min at 12,000 g. Note: Pellet contains...Optional) Add 5 μL of 2 mg/mL RNase A to the supernatant in the new tube and incubate at 37 °C for 5 min. Note...are worried about losing the pellet. Dry with vacuum or by inverting over paper towel for 5-20 min. Resuspend...200 μL of Solution II and invert the tube carefully 5 times to mix the contents. The contents will become...purified plasmid DNA. Incubate solution on ice for 5 min. Add 150 μL of cold Solution III to each tube....microfuge tube for 30-60 sec. Centrifuge the tube for 5 min at room temperature on the highest setting. Note... overnight OR -80 °C for 30 min OR on dry ice for 5 min. Note: This freezing may help the DNA to precipitate...

...restriction site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC...consist of: Leader Sequence: Extra base pairs on the 5' end of the primer assist with restriction enzyme ...Therefore, our Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds..., resulting in a final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse...final 18bases of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC...restriction enzyme digestion. This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with...put the sequence we chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this...

...guanine or cytosine is used at the 3’ end, and the 5’ end of the primer usually has stretches of several...) of 50-60°C Primer pairs should have a Tm within 5°C of each other Primer pairs should not have complementary...If you will be including a restriction site at the 5’ end of your primer, note that a 3-6 base pair "clamp...amplification process. When designing, if unsure about what nucleotide to put at a certain position within...capabilities. Taking into consideration the information above, primers should generally have the following properties...

...mL conical tubes NanoDrop spectrophotometer 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm...pipette Reagents Aspirating pipette, VWR 414004-265 5 mL pipette, VWR 89130-896 10 mL pipette, VWR 89130...PD10 Buffer Reservoir, Millipre Sigma GE18-3216-03 5% Sodium Azide, 500 mL, VWR 7144.8-16 PBS, 1X pH 7.4...tubes. Cap the Gravitrap columns at the bottom. Add 5 mL of Pierce IgG Elution Buffer to the capped Gravitrap...hydrochloride pH 9.0. Cap the tubes and vortex for 5 s to mix. Determine the protein concentration of each...Discard the flow through into a waste container. Add 5 mL PBS to the column. Centrifuge at 1000 x g for 2...personal protective equipment including laboratory coat, laboratory goggles, and gloves. Sodium azide containing...

...viral stock 240 µL 400 µL 5 200 µL of 2.5-fold dilution 200 µL 400 µL 10 200 µL of 5-fold dilution 200 µL ...heat inactivated premium grade, fetal bovine serum 5 mL glutaGRO 50 U/mL benzonase: 15 mL DMEM Complete...from 25–1600-fold. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well is 1.5 mL, ...transfer to a microcentrifuge tube. Centrifuge for 5 min at 100 x g . Gently aspirate supernatant. Wash...Wash cell pellets in 500 µL PBS. Centrifuge for 5 min at 100 x g . Gently aspirate supernatant. Extract ...additional 10-fold dilution into 6-well plate 2.5 25 5 50 10 100 20 200 40 400 80 800 160 1600 To calculate...0.2045454545 8.18E+06 4 100 3180 20540 0.3096397274 6.19E+06 5 50 8960 17080 1.049180328 1.05E+07 6 25 14440 24260...

...cells. Allow sample(s) to sit at room temperature for 5 minutes to allow for dissociation of the nucleoprotein...Ethanol and vortex for a few seconds. Centrifuge for 5 minutes at 10,000 x g at 4 °C and remove the supernatant...without disturbing the pellet. Air-dry the pellet for 5-10 minutes. *Critical* It is important to not let ... working with the volatile reagents in the list above. Procedure Option #1 - Solution D Protocol Before...

...cool down to about 50 °C (about when you can comfortably keep your hand on the flask), about 5 mins. (Optional...container filled with 100 mL of TAE running buffer and 5 μL of EtBr, place on a rocker for 20-30 mins, replace...replace EtBr solution with water and destain for 5 mins. Using any device that has UV light, visualize your...electrophoresis (PAGE), which is typically used to separate 5 - 500 bp fragments. How do you get better separation...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr... of the tip of the pipette into the buffer just above the well. Very slowly and steadily, push the sample... of the way down the gel. A typical run time is about 1-1.5 hours, depending on the gel concentration ...

...resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice between each pulse,...resuspend the pellets in a total of 5 mL of cell lysis buffer (recipe above). Pipet back and forth to resuspend.... T-175 flask, Corning 430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269...high glucose, add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO 11 mL of 200 mM L-alanyl-L-glutamine... water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride....8-fold. See the recipe for D1 + 0.1 M sorbitol above. Carefully pour off the media into a waste container...pellets and keep on ice. Process the cell pellet from above as follows: Resuspend and lyse the cells by adding...

...can be created via PCR with primers that contain a 5′ end that is identical to an adjacent segment and ...single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary DNA fragments can subsequently... to several hundred kilobases. Nature Methods , 6(5), 343–345. https://doi.org/10.1038/nmeth.1318 (Link... the right). When designing your plasmid, think about what DNA segments you will need to join to create...

...DMEM complete + 10 µg/mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500...well gets one dilution, so a 6-well plate will hold 5 dilutions plus one 'no virus' control well). Perform...cells in the untransduced well (0 µL lentivirus, above) are dying. Perform regular media changes and monitor...

...confirm. Addgene's plasmid information pages recommend 5’ and 3’ sequencing primers. These primers typically...Addgene lists the primers used to obtain each result above the posted sequence in the "View Sequence" link....sequence than expected and wish to contact Addgene about the accuracy of your plasmid, please email help@...

... µL, 10 µL) Bacti Cell Spreaders (VWR, 60828-680) 5 mL and 10 mL Serological pipettes Ice slurry (Ice ... mL Vented Falcon Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate...require modifications dictated by the originating laboratory for optimal results. If you obtained the pooled...

...Recommended Concentration Ampicillin 100 µg/mL Bleocin 5 µg/mL Carbenicillin 100 µg/mL Chloramphenicol 25 µg...suggested amount, instead of the other dry ingredients above. Media without growth (top) and with growth (bottom...

...Klenow DNA Polymerase I for 3′ overhang removal and 5′ overhang fill-in. If you are using blunt ends or ...glycerol concentration. Learn more at NEB's website about star activity . If you are digesting a large number...