Skip to main content

We narrowed to 15 results for: abo.5

Showing: 1 - 15 of 15 results
  1. Sequencing Primers

    Type
    Guide
    ...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse L4440 AGCGAGTCAGTGAGCGAG 5' of MCS in L4440 vector Forward...LacI-R GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA... pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...GTTGCCTTTACTTCTAGGCCT 5' of EcoRI site in pcDL vector Forward pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...U5 in cis Unique 5'; in third-generation plasmids, this region is often removed in 5’ LTRs and replaced.... Second-generation plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid...Instead, the transfer plasmid contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or...self-inactivating (SIN). This deletion is transferred to the 5’ LTR after one round of reverse transcription, inhibiting...Transfer plasmid — contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging...self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused to a heterologous...the lentiviral vectors from your plasmids (Figure 5). This process requires a production cell line, typically...
  3. Molecular Cloning Techniques

    Type
    Guide
    ...one isothermal reaction. First, the 5’ exonuclease chews back the 5’ ends of your DNA fragments, generating...dsDNA of interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no...specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This fragment can...properties of three common molecular biology enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly...DNA polymerase then closes the gap created by the 5’ exonuclease. Finally, ligase seals the nicks in the...has the potential to be completely degraded by the 5' exonuclease. Read more in our Gibson Assembly blog...more in our Golden Gate Cloning blog post . Figure 5: Summary of Golden Gate cloning. Created with BioRender.com...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...sequence. U5 in cis Unique 5'; in some newer plasmids, this region is removed in 5’ LTRs and replaced with... of the viral genome that is transferred into the 5' LTR after one round of reverse transcription. After...with a heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript...transcript begins at the beginning of R, has a 5' cap structure, and proceeds through U5 and the rest of...of the provirus. Some newer plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV...3' LTR in cis Terminates transcription started by 5' LTR by the addition of a polyA tract just after the...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and...
  5. CRISPR Guide

    Type
    Guide
    ...bacterium (LbCpf1) 5' TTTV AsCpf1 RR variant 5' TYCV LbCpf1 RR variant 5' TYCV AsCpf1 RVR variant 5' TATV Campylobacter...sequence may not be characterized *In the table above, 3' and 5' indicate on which end of targeted sequence...will continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches...inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit target cleavage...from naturally occurring cytidine deaminases. Figure 5: Overview of base editing. More recently, researchers...transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex is resolved ... repair using the edited strand as a template PE4/5 — improved PE2/PE3 to inhibit mismatch repair to promote...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...using two numbers separated by a slash (e.g. AAV2/5), where the first number indicates the serotype of...transduction efficiency and alter tropism. For example, AAV2/5, targets neurons that are not efficiently transduced...pieces of the transgene. The first vector contains the 5' portion of the gene and a splice donor sequence at...of the gene with a splice acceptor sequence at its 5' end. When these viral vectors co-infect a cell, they...much less efficient than with a single rAAV vector (∼5%). Gene fragments can also be reassembled via homologous...pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after... 317–334. https://doi.org/10.1007/s40259-017-0234-5 (Link opens in a new window) PMID: 28669112 (Link ...
  7. Adenovirus Guide

    Type
    Guide
    ...cells. Most rAdV vectors are based on adenovirus type 5 (Ad5) and have been produced by replacing the early...on our Adenovirus Plasmid Collection page . Figure 5: Overview of AdEasy™ adenoviral vector production ...), 3613. https://doi.org/10.1038/s41598-020-60238-5 (Link opens in a new window) PMID: 32107394 (Link ... of Sciences of the United States of America, 95 (5), 2509–2514. https://doi.org/10.1073/pnas.95.5.2509...adenoviruses using the AdEasy system . Nature Protocols, 2 (5), 1236–1247. https://doi.org/10.1038/nprot.2007.135...Journal of Genetic Syndromes & Gene Therapy, Suppl 5 , 001. https://doi.org/10.4172/2157-7412.s5-001 (Link...relative to transgene Purpose Transfer/Shuttle plasmid 5' ITR (LITR) in cis Left Inverted Terminal Repeat, ...
  8. Chemogenetics Guide

    Type
    Guide
    ...PSAM-5HT3 PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective...Striatopallidal Neurons. Neuropsychopharmacol, 38 (5), 854–862. https://doi.org/10.1038/npp.2012.251 PMID...genetically engineered receptors. J Biol Chem, 266 (1), 5–8. https://doi.org/10.1016/S0021-9258(18)52392-9 PMID...hardware-independent optogenetic inhibition. Sci Rep, 5 , 14366. https://doi.org/10.1038/srep14366 PMID: 26399324...to clinical translation of chemogenetics. Sci Adv, 5 (4), eaaw1567. https://doi.org/10.1126/sciadv.aaw1567.... However, CNO is back-metabolized to clozapine and other clozapine metabolites and these can have off-target...concentrations of clozapine N ‐oxide (CNO). CNO is a metabolite of the antipsychotic clozapine and seems to be...
  9. Promoters

    Type
    Guide
    ...Promoters are about 100–1,000 base pairs long and are adjacent and typically upstream (5’) of the sense...two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions from the transcription...Learn about bacterial and eukaryotic promoters, including transcription and the transcription complex...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
  10. Plan Your Experiment

    Type
    Guide
    ... regions, 5’ exons, or an exon known to code for an essential protein domain. Targeting a 5’ exon reduces...CRISPR/Cas9-based genome editing. Scientific Reports , 5 , 11315. https://doi.org/10.1038/srep11315 PMID: 26066060...exon coding for an essential protein domain could abolish protein activity and essentially function as a ...reference sequence you used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired... other downstream methods. For more information about viral vectors and their production, see our viral...and Proteins In addition to the methods described above, you can also directly deliver mature mRNA or purified... approach. Similar to the mRNA method described above, this method is also transient, as the RNPs will...
  11. Molecular Biology Reference

    Type
    Guide
    ...supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC...specialized membranes containing nanopores (Figure 5). A motor protein then unwinds double-stranded DNA... plasmid sequences can be read in one run. Figure 5: Summary of long-read Nanopore sequencing. Created...Learn about the basics of molecular biology, including molecular genetics, plasmids, sequencing, and ...human genome with restriction enzymes would yield about two million DNA fragments, which is far too many...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...endogenous expression levels. For more information about promoters, check out our promoters reference page...
  12. Guide to Using Pooled Libraries

    Type
    Guide
    ...CRISPR pooled library posts Content last reviewed: 5 January 2026...Learn all about plasmid pooled libraries, how to amplify and use them, and what types of experiments ...variant effect mapping studies. You can learn more about CRISPR tools in our CRISPR Guide . There are multiple...for the best results. If you have any questions about the library protocols, feel free to contact us at...simultaneously in a single reaction. As discussed above, access to this technology is crucial for conducting...Resources Addgene Pooled Library Resources Learn about Pooled Library Handling and Storage . Deposit a ...
  13. Modular Cloning Guide

    Type
    Guide
    ... transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding gene, and...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and more...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ... Techniques by Nicola Patron at The Sainsbury Laboratory Weber E, Engler C, Gruetzner R, Werner S, Marillonnet...
  14. Optogenetics Guide

    Type
    Guide
    ...inhibition of neuronal activity in vivo. Sci Rep, 5 , 14807. https://doi.org/10.1038/srep14807 PMID: 26443033...Learn about using Optogenetics plasmids in your lab, including microbial opsins and optical switch systems...Optogenetics Plasmid Collection , or read on to learn more about these tools. Figure 1: A typical optogenetics experiment...optics, making LMOs a versatile option. Learn more about LMOs and other chemogenetic systems in our Chemogenetics...
  15. Antibody Guide

    Type
    Guide
    ...but both rely on the same general strategy. Figure 5: Immunoprecipitation using bead-based antibody capture...are often used in clinical applications. Diabodies - Diabodies contain two Fab fragments, each recognizing...cells isolated from animals immunized as described above are used to create hybridomas, which produce large...different epitope, bound by short peptide linkers. Diabodies can be used for assembling protein nanostructures... Includes: Flow cytometry Read on to learn more about the applications common to each category, including...controls, and any special considerations to think about. For step-by-step instructions of many of these ...protein of interest, as described in the IP section above. Reverse the crosslink, isolate DNA, and perform...
Showing: 1 - 15 of 15 results