We narrowed to 732 results for: SON

1. Hot Plasmids - January 2023

   Type

   Blog Post

   ...reproducibility of a (recombinant) monoclonal. Another reason is that some antibodies may just not perform as...

2. With Our New Viral Service, We're Taking CRISPR Further!

   Type

   Blog Post

   ...that total with the indicated function. One huge reason CRISPR has become such a popular genome editing...

3. Addgene Welcomes John Doench to the Advisory Board

   Type

   Blog Post

   ...Addgene has behind it is something that very much resonates with me.” About Addgene’s role in the future,...

4. Plasmids 101: How to Verify Your Plasmid Using a Restriction Digest Analysis

   Type

   Blog Post

   ... Lianna Swanson...

5. Sequencing Primers

   Type

   Guide

   ...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

6. Communicating Your Science With Help From ComSciCon

   Type

   Blog Post

   ...mediated by some kind of communication to another person.  In an interview setting, this means persuading...

7. AAV Q&A with Tim Miles

   Type

   Blog Post

   ...thanks to our panel of experts, Tim Miles, David Goertson, Xinhong Chen, and Miggy Chuapoco, and to all ...

8. GPCRs: How Do They Work and How Do We Study Them?

   Type

   Blog Post

   ...detect G protein activation via bioluminescence resonance energy transfer 2 (BRET2). Check out our blog ...

9. A Quick Guide to a Career in Software Product Management

   Type

   Blog Post

   ...UK) to help solve those problems.  What type of person goes into software product management? I always...

10. Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies

    Type

    Blog Post

    ...chromosome. Targeted Insertion allows for direct comparisons between lines expressing different variants of...

11. Luminescent Imaging with Nano-lanterns

    Type

    Blog Post

    ... is based on the principle of bioluminescence resonance energy transfer (BRET). Photons emitted by a Renilla...

12. Flow Cytometry Readouts: Yes, No, and Everything in Between

    Type

    Blog Post

    ...population cluster would be shifted to the right in comparison, say somewhere between a 104–105 signal intensity...

13. Viral Vectors 101: Biosensors

    Type

    Blog Post

    ...monitor with biosensors? You can keep tabs on my personal favorite (the caffeine of the cell!)—ATP. There...

14. GCE4All: Making Genetic Code Expansion Accessible

    Type

    Blog Post

    ...  Rachel Leeson...

15. Viral Vectors 101: The AAV Retrograde Serotype

    Type

    Blog Post

    ...Haery in 2017 and significantly updated in 2023 by Jason Nasse.  References 1. Tervo, D. Gowanlock R., et...

16. Viral Vectors 101: Viruses as Biological Tools

    Type

    Blog Post

    ...electroporation of a human, for example, isn’t a reasonable option. Since viruses used in labs are derived...

17. Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs

    Type

    Blog Post

    ...in the graphic below - including some simple comparisons. The easy multiplexing afforded by PTGs will...

18. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type

    Blog Post

    ...Repression and Activation. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes...

19. Summer SciComm: Preprints

    Type

    Blog Post

    ...scientific communication needs. The most often-cited reasons researchers might not post a preprint are reluctance...

20. Antibodies 101: Secondary Antibodies

    Type

    Blog Post

    ...  Rachel Leeson...

21. Antibodies 101: Polyclonal Antibodies

    Type

    Blog Post

    ...will still recognize your protein. For the same reason, they’re also useful in experiments where the availability...

22. Channelrhodopsins with improved light sensitivity for minimally-invasive optogenetics

    Type

    Blog Post

    ... the brain.  References Bedbrook CN, Yang KK, Robinson JE, Mackey ED, Gradinaru V, Arnold FH (2019) Machine...

23. RNA Extraction Without A Kit

    Type

    Blog Post

    ...purification without a kit that outlined several reasons why doing something without a kit has advantages...

24. Gendered Innovations: Why Does Sex of the Cell Matter?

    Type

    Blog Post

    ...the market between 1997 and 2000. There are many reasons why drugs fail - sex is one of them. Why might ...

25. Enhancing CRISPR Targeting Specificity with eSpCas9, SpCas9-HF1, & HypaCas9

    Type

    Blog Post

    ...off-target sites from being cut. Slaymaker et al reasoned that, if they decreased the positive charge in...

26. Troubleshooting Your Plasmid Cloning Experiment

    Type

    Blog Post

    ...you are going to adopt (i.e. restriction cloning, Gibson Assembly, Golden Gate etc.), and try to find the...

27. Plasmid Tools for Microbiome Studies

    Type

    Blog Post

    ...validated their platform on clinical stool samples by comparison to qPCR and demonstrated that it can also detect...

28. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

    Type

    Blog Post

    ...series of plasmids to study PPI using Förster Resonance Energy Transfer (FRET, Heckler et al., 2015) or...

29. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type

    Blog Post

    ...fluorescent proteins in empty backbones in the Michael Davidson Collection Find Photoswitchable Fluorescent Proteins...

30. CRISPRainbow and Genome Visualization

    Type

    Blog Post

    ...loci Building on the work of Chen et al., Thoru Pederson’s lab used CRISPR to label multiple loci in distinct...