We narrowed to 717 results for: CaS;

...their data months or years before others. In some cases, typically consortia involving genomic screens, ...the originating researchers, even if they are occasionally beaten to press, as there is so much analysis...track the motion of multiple animals on different occasions via video, generating huge amounts of data. When...

... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma ...

...complement each other to restore the full-expression cassette. AAV’s natural ability to reassemble fragmented...sequential homology directed repairs (HDR) with CRISPR/Cas9. Donor A contains: 400bp homology arms to the site...2017) CRISPR-Mediated Integration of Large Gene Cassettes Using AAV Donor Vectors. Cell Reports 20:750–756...

...in lentiviral or retroviral backbones. On some occasions, shRNAs are transiently expressed using either...promoters with no tissue specificity, so in some cases they can lead to toxicity and off target effects... an Old Favorite CRISPR 101: Targeting RNA with Cas13a (C2c2) Plasmids 101: The Promoter Region – Let'...

... an intact sample, a cell in the case of ICC or a tissue in the case of IHC. IF is used specifically when...interest within an intact cell, tissue, or, in some cases, a whole organism. But, as with any antibody-based...

...(Mouse IgG2a) Goat anti-mouse IgG2a CASPR anti-CASPR mAb K65/35 (Mouse IgG1) Goat anti-mouse...Neocortex labeled with anti-pan-Nav (magenta), anti-CASPR (green), and anti-Kv2.1 (cyan). (B) Cerebellum labeled...

...plasmid with repeating sequences. In some specific cases, multimerization has been observed to occur more...reduce the frequency of multimerization, and in some cases completely prevent the formation of plasmid multimers...Sharratt, 1984; Summers et al., 1993). In these cases, screening multiple bacterial colonies using one...

...environmentally friendly organization on the planet, in which case whoa! Mission accomplished! One example of a mission-based... a little bit about everything or in Jefferson’s case, even a lot about everything. Fast forward a few...received 104 million results (Here’s the top one, in case you’re interested). “But I’m an introvert!” is not...

...can alter the structure of the protein. In some cases this can lead to changes or a complete loss of protein...lipids including those of the cell membrane. In some cases, this can mask epitopes such that immune complexes...only enter cells with disrupted membranes as is the case with dead or dying cells. DNA binding dyes are not...

...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...

...consideration for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain..., J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343...

...In the fourth episode of our Hot Plasmids podcast series, you'll learn about new libraries for studying...the audio engineer and producer for the Addgene Podcast.     Additional Resources on the Addgene Blog ...

...the dramatic spread of the Cas9 technology: "The rapid adoption of the Cas9 technology was also greatly...

..., and bidirectional transport for AAV1, -8, -9 (Castle et al., 2014). Differences between AAV serotypes...space along an axon, this does not seem to be the case for either AAV1 or AAV9. It should be noted that...PMID: 25555356. PubMed Central PMCID: PMC4324159. Castle, M.J., Gershenson, Z.T., Giles, A.R., Holzbaur,...

...of CRISPR, Addgene gave to me: RNA editing with Cas13.  On the tenth day of CRISPR, Addgene gave to me...to me: methods for adenoviral delivery of CRISPR/Cas9.  On the twelfth day of CRISPR, Addgene gave to ...

...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

...unsuccessful. Listen to the interview with Crystal Shih Podcast breakdown Intro Chapter 1: Who is Crystal Shih?...the audio engineer and producer for the Addgene Podcast.      Additional Resources from Addgene Find more...

...Community.” This post leads readers to our latest podcast all about graduate student life and how establishing...Community Engineering the Plant Genome Using CRISPR/Cas9 Healthcare Consulting: A Door to the Business of...

...and a project. Listen to the interview here! Podcast Breakdown (Time : Topic) 0:00 - 0:28 : Niroshi ...the audio engineer and producer for the Addgene Podcast.     Additional Resources on the Addgene Blog ...

...contains and other important information. Tip: A lowercase "p" is often used as the first letter of a plasmid...pBACKBONE-hGene Tip: Often researchers will add a lower case letter to the beginning of their insert abbreviation...