Skip to main content

We narrowed to 13 results for: CaS;

Showing: 1 - 13 of 13 results
  1. Plan Your Experiment

    Type
    Guide
    ...utilized for CRISPR/Cas gene editing. This image summarizes ways that the CRISPR/Cas system can be delivered...target cells translate the mRNA encoding Cas to produce the Cas enzyme, and the enzyme then forms a complex...directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You then ... joining (NHEJ) at the cut site Cas9 or Cas9 nickase High-fidelity Cas enzymes increase specificity Dual-nickase...components (Cas enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog...deliver Cas-gRNA ribonucleoprotein (RNP) complexes directly into your target cells. In this case, your ...
  2. CRISPR Guide

    Type
    Guide
    ...type I Cas effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3...Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas Enzymes and PAM Sequences...application. Cas9 Orthologs While SpCas9 is the most commonly used Cas enzyme, additional Cas9 orthologs ...editing with Cas3. Browse Plasmids: Cascade-Cas3 Want more information on the wide variety of Cas enzymes?...from. Many variations of Cas9 exist, along with other Cas enzymes like Cas12a, which are available for...paired with the appropriate Cas enzyme. Specific enzymes, such as Cas12a or Cas13 , can improve multiplexing...Other natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9 (from Neisseria...
  3. Modular Cloning Guide

    Type
    Guide
    ...efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas Toolkit for Plants Genome Engineering, CRISPR...Expression Vladimir Nekrasov 95 plasmids including CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters...CRISPR/Cas9 vectors expressing multiple gRNAs (up to seven) with a Cas9 nuclease, nickase, dCas9, or dCas9...mechanisms. zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome Engineering...assembly of CRISPR/Cas9 constructs for use in plants. The constructs are made with zCas9i, a high efficiency...create plant expression vectors containing several cassettes and generate multi-construct transgenic plants...biology and multigene engineering, including CRISPR/Cas9 components. MoChlo: Modular Cloning Chloroplast ...
  4. Chemogenetics Guide

    Type
    Guide
    ...hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al., 2007 ...
  5. Adenovirus Guide

    Type
    Guide
    ...gene expression cassettes are often too big to be packaged in rAAV vectors. This is the case of some commonly...capacity is large enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. ...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain... or when needing to package larger cargo. CRISPR-Cas9 Delivery As compared to other viral vectors, rAdV...commonly used Cas9 homologs, especially when having to express them alongside a guide RNA and other regulatory...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Addgene. CRISPR/Cas9 Delivery rAAV vectors are a popular choice for the delivery of CRISPR/Cas9 elements, making... genome editing. Packaging the Cas9 from Streptococcus pyogenes (SpCas9) and a gRNA together into an rAAV...this obstacle, has been to use smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus . The Feng...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...Feng Zhang lab has developed plasmids containing SaCas9 optimized for their use in rAAV vectors . Read ...too large to fit within the rAAV capsid, such as Cas9-derived plasmids and base/prime editors, is to create...
  7. Sequencing Primers

    Type
    Guide
    ... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma ...
  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...
  9. Lentiviral Vector Guide

    Type
    Guide
    ...consideration for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain..., J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343...
  10. Antibody Guide

    Type
    Guide
    ...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...consideration for oncogenes should be made on a case-by-case basis. Retroviruses carry a slightly elevated...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...
  12. Optogenetics Guide

    Type
    Guide
    ...thus expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated...
  13. Molecular Biology Reference

    Type
    Guide
    ...During replication, the DNA helix is unwound by a helicase, the enzyme that breaks the hydrogen bonds between...
Showing: 1 - 13 of 13 results