Skip to main content

We narrowed to 940 results for: KIN

Showing: 501 - 520 of 940 results
  1. Summer Fun at Addgene!

    Type
    Blog Post
    ...common techniques and concepts. But what if you’re looking for information beyond the 101? That’s where our...our YouTube channel and watch it now! (Bonus: Tim kindly offered to finishing answering all submitted questions...check out our Instagram all summer long to see what kind of shenanigans we get into!  We hope you are as ...
  2. Promoters

    Type
    Guide
    ...Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter...
  3. Interview with Bart Newland, Addgene’s Newest Board Member

    Type
    Blog Post
    ... used to thinking about the downstream results of actions. I’m also pretty adept at thinking about risks...was in the early 80s, and biotech was really just taking off. I found out that patent attorneys with a biology...
  4. A Scientist's Guide to Ebola

    Type
    Blog Post
    ...s not the virus itself that kills you, but the cytokine storm it ultimately sets off.  The virus works...only viral protein present on the virion surface – making it critical for viral attachment and fusion. Once...attachment and fusion. Recommended Reading For those looking to delve deeper or stay tuned, there are plenty...
  5. Addgene's Top Blog Posts from 2020

    Type
    Blog Post
    ... expand reagent sharing even broader and began working with tech transfer offices to make reagents available...Plasmid Incompatibility by Leah Schiesow If you're thinking about hosting multiple plasmids in one cell, it...this year and along with it, wrote these tips for working with RNA and extracting RNA without a kit. 3. ...
  6. Microbes: Look, Listen, and Tell

    Type
    Blog Post
    ...2018 Microbe meeting. Soon after I arrived, I was looking through a paper-based, affordable, and portable...fascinated by the world that reveals itself when looking down a paper thin and very portable microscope....the scientist in everyone - everywhere! From ‘looking at’ to ‘listening to’ microbes But seeing microbes...
  7. Editor's Choice, August 2016

    Type
    Blog Post
    ...CRISPR For my editor’s choice picks this month, I’m picking two posts that describe methods to make single ...posts throughout the month including a first of its kind for the Addgene blog - Addgene Software Engineer...Executive Director Joanne Kamens. I highly recommend taking a look at all of our posts as each one has something...
  8. Top 10 Open Science Developments of 2013

    Type
    Blog Post
    ...this interest in the ways science is shared and in making it easier to share, we take special note as the...bump in citations for their trouble, even when all kinds of other factors, including journal impact factor...Way to Share Science, in honor of a decade spent making plasmids more accessible and easier to share. As...
  9. Seeing Red: Simple GFP Photoconversion

    Type
    Blog Post
    ...protein tracking in vivo. Sci Rep. 2015 Jul 7;5:11771. doi: 10.1038/srep11771. PubMed. McKinney SA, Murphy... the 1990s, biologists have spent a lot of time making things glow. Chances are you’ve used a GFP derivative...
  10. CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]

    Type
    Blog Post
    ...Experiments (JOVE). The video publication by Stuart Orkin and Daniel Bauer's labs details the use of CRISPR...biallelic deletion clones:    Like the video? The Orkin and Bauer lab's related paper describes their methods...Harvard Medical School in the laboratories of Stuart Orkin and Daniel Bauer. He received his BSE in Bioengineering...
  11. Celebrating Accomplishments in the Lab

    Type
    Blog Post
    ...of lab BBQ parties - despite BBQs being wishful thinking in England. The Cepko Lab throws going away parties...celebrate each other's accomplishments? Any tips on making time to relax and/or enjoy time away from the bench... Dr. George Church (Harvard Medical School) for taking the time to speak with us throughout this series...
  12. Three Tips to Organize Your Lab Notebooks in the New Year

    Type
    Blog Post
    ...write brief descriptions on each. Place the notes sticking up out of the top of the notebooks, so that you...use the search bar to quickly find what you’re looking for. Tip 3: Share protocols and spreadsheets with... knowing the information is backed up and edit tracking will help you identify when others have added ...
  13. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...nLightR greatly expand the toolbox for researchers looking to study norepinephrine, the Patriarchi lab continues...Ovchinnikov, S., & Steinegger, M. (2022). ColabFold: Making protein folding accessible to all. Nature Methods...Technique is Best for Me?  In Living Color: The Skinny on In Vivo Imaging Tools Resources on Addgene....
  14. Future of Research Conference - Remarkable Opening Session

    Type
    Blog Post
    ...because it finally feels to me like the postdocs are taking some steps to control their own future in science...speaker, Dr. Henry Bourne (shown in photo), has been speaking out and writing about issues in our science training...experience and encouragement.  Dr. Sibby Anderson-Thompkins, Director of the Office of Postdoctoral Affairs...
  15. SpyLigase Irreversibly Locks Peptides Together for Efficient Cell Capture

    Type
    Blog Post
    ...Streptococcus and the “py” in pyogenes), capable of locking two peptide tags together. SpyLigase overcomes ...forces acting on them. For the application we were looking at, magnetic isolation of circulating tumor cells..., highly stable and has this amazing chemistry locking the domain together - no one knows what for. Many...
  16. Sequencing Primers

    Type
    Guide
    ... Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria...
  17. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ... no fear — plasmids from Addgene depositors are making it easier than ever to use CRISPR in E. coli and...gene body can repress transcription by physically blocking the elongation complex from binding the DNA or...Patino R, Heussler GE, Hearne CC, Qu J, Inclan YF, Hawkins JS, Lu CHS, Silvis MR, Harden MM, Osadnik H, Peters... Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA (2013) Repurposing CRISPR as an RNA-Guided...
  18. Plasmids 101: Positive and Negative Selection for Plasmid Cloning

    Type
    Blog Post
    ... cells containing the plasmid construct you’re seeking. Fortunately, there are many ways to do this involving... a successful uptake of your DNA of interest by taking advantage of bacterial characteristics such as ...for specific amino acids. When plated on media lacking the essential amino acid, the bacteria will only...
  19. Sensing Neuronal Dopamine

    Type
    Blog Post
    ...also involved in reinforcement learning, decision making, and motor control.  What do we understand about... 100 nm) of DA. In addition, they exhibit fast kinetics (10 ms on and 100 ms off), enabling detection ...magnitudes of fluorescent responses. Studies on the kinetics of these sensors showed rapid response (60 or ...
Showing: 501 - 520 of 940 results