Skip to main content

We narrowed to 15 results for: KIN

Showing: 1 - 15 of 15 results
  1. Optogenetics Guide

    Type
    Guide
    ...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson's disease, depression, drug addiction, and more...less invasive than implantation of fiber optics, making LMOs a versatile option. Learn more about LMOs ...compared to CrChR2 450 ChETA E123T mutation; faster kinetics but reduced photocurrent amplitude 490 ChR/T159C...ChrimsonR carries K176R mutation with increased on/off kinetics 590 ChRmine Red-shifted channelrhodopsin from ...mutations; increased photocurrent amplitude, on/off kinetics, and red-shifted peak action spectra 540 HcKCR...increased photocurrent amplitude; eNpHR3.0 includes trafficking signal from Kir2.1 and ER export signal for improved...
  2. Molecular Biology Reference

    Type
    Guide
    ...Molecular Genetics The Genetic Code Recombinant DNA Working with Plasmids Plasmid Elements Types of Plasmids... genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today, scientists can easily study...to break chromosomes down to study their genes, marking the birth of molecular genetics. To learn more ... number of E. coli strains below and recommend checking out Addgene’s blog posts about common E. coli ...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin... to the sequence of the complementary strand. Mimicking the DNA replication process requires the four ...
  3. CRISPR Guide

    Type
    Guide
    ...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living... the most scalable genome editing technologies, making CRISPR perfect for genome-wide screens. This guide...very close proximity to the region to be edited, making the PAM sequence (NGG) limiting. This PAM is abundant...inhibit CRISPR by a variety of mechanisms, including blocking crRNA loading or PAM recognition, inhibiting Cas9...sites is sufficient to repress transcription by blocking initiation. More robust transcriptional repression...repression through cytosine methylation with improved kinetics LSD1 — repression through targeted removal of ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...
  4. Chemogenetics Guide

    Type
    Guide
    ...exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer Receptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at... workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter bioluminescent...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine's actions? Psychopharmacology, 178 (... PMID: 26889809 Slaviero, A. N., Gorantla, N., Simkins, J., Crespo, E. L., Ikefuama, E. C., Tree, M. O...
  5. Adenovirus Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...response in different ways, such as expressing cytokines and other immune-modulatory molecules. Another...occur with contact to mucous membranes or broken skin. The risk of exposure and reaction severity is increased... He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein, B. (1998). A simplified system... J., Sharff, K. A., Luu, H. H., Haydon, R. C., Kinzler, K. W., Vogelstein, B., & He, T. C. (2007). A protocol...
  6. Antibody Guide

    Type
    Guide
    ...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes...
  7. Guide to Using Pooled Libraries

    Type
    Guide
    ...barcodes will then be inherited by any daughter cells, making barcode libraries ideal for lineage tracing. Barcode...treatments, deconvolution of pooled perturbations, and linking perturbations to single-cell phenotypes. These ...tumors. Advantages Extremely high resolution clonal tracking Low biological perturbation Limitations No functional...target genes, where it represses expression by blocking transcription initiation or modifying local chromatin...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...choice for the delivery of CRISPR/Cas9 elements, making it one of the most common methods for in vivo CRISPR-based...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...pioneering solutions for human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https:/...
  9. Molecular Cloning Techniques

    Type
    Guide
    ... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that you have...site-specific recombination or a ligation step, making it an easy, cheap, and rapid cloning method. LIC...it can be a major time- and cost-saver for labs working with yeast. Figure 7: Summary of yeast-mediated...
  10. Plan Your Experiment

    Type
    Guide
    ...setting up CRISPR experiments. We will focus on making single edits using CRISPR/Cas9 in mammalian cells... the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature, ...efficiency. Edit Type The type of edit you are looking for will ultimately depend on which CRISPR method...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...
  13. Promoters

    Type
    Guide
    ...Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter...
  14. Sequencing Primers

    Type
    Guide
    ... Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria...
  15. Modular Cloning Guide

    Type
    Guide
    ...integrative or self-replicating plasmid vectors for working in cyanobacteria. Cultivarium POSSUM Toolkit Bacterial...
Showing: 1 - 15 of 15 results