...environment itself. At Addgene we hope that all parties involved in making academic research a successful and enjoyable...

...signaling GPCR signaling is a complicated process involving many downstream signaling mechanisms that are ...

...factors to consider. First, the titer required is inversely related to transduction efficacy: the higher the...

...during our quality control process. Since MiSeq involves sequence assembly from short reads (<300 bp) which...

...through CRISPR/Cas9 knock-in. Finally, NLuc is very inviting for endogenous protein tagging as it is only 19...

...then the result of their recombination is the inversion of the DNA between them (Fig. 1A below). In the...

...easy. In the 1980s, gene targeting technology was invented to introduce specific changes into the mouse genome...

...base of former mentees, we encourage them to get involved and give back by becoming mentors to new students...

...growing so slowly, there isn’t much maintenance involved. Also it was really fun to find individual colonies...

...remains exposed for a longer time. The aerosols are invisible to naked eyes and hence cannot be detected until...

...- it is hard to distinguish between specific, invariable expression and non-specific, background signal...

...Harvard Medical School. His projects include investigating negative regulators of T cells and cytokine ...

...model organisms and backgrounds, MoClo can be invaluable for more complex editing and screening experiments...

...were able to extravasate from the bloodstream to invade lymph nodes and scan antigen presenting cells, ...

...purchased directly from commercial suppliers without investing time and labour on reagent preparation in the ...

... non-scientists alike, need to stay active and involved if we wish to make positive change. Below I present...

...deposit, associate the plasmids with a Principal Investigator (PI), provide us with your shipping address ...

...combinatorial mammalian genetics.” Journal of Clinical Investigation 125(4) (2015):1603-19. PubMed PMID: 25751063...

... cells of choice. The dedifferentiation stage involves overexpression of four reprogramming factors- ...

...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...