We narrowed to 538 results for: shi

...were space and robots. Warping to stars in space ships and the rise of killer machines that exterminate...

...gene delivery in an efficient and non-pathogenic fashion. Work improving AAV tissue tropism, transduction...

..., which I’d say is pretty amazing. Despite the shifting landscape of research opportunities, it’s an exciting...

... of comparisons. The Bonferroni does this by establishing a significance threshold at a p value less than...

...manager at genOway.     Acknowledgement:Through a partnership with genOway, we are able to distribute materials...

...genotyping, is critical to demonstrating causal relationships between genotype and assayed phenotype. Verifying...

...primers flanking the tag sequence and expect a size-shift in the PCR product for knock-in lines. Troubleshooting...

...appropriate containers. The machine is useful for distinguishing cell populations that have been tagged with...

...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

...plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering in human...

... of an orthogonal approach to understand the relationship between antibody staining intensity by flow ...

...software. This category is important for users wishing to select tools based on their comfort level with...

...Masayuki, Minoru Iijima, Manami Ohtaka, and Mahito Nakanishi. "Novel Strategy to Control Transgene Expression...

...Huggett J; Kubista M; Mueller R; Nolan T; Pfaffl MW; Shipley GL; Vandesompele J; Wittwer CT. The MIQE guidelines...

...bacterial CRISPR engineering One common way of accomplishing bacterial genome engineering is done with recombineering...

...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...

...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...

...) PMID: 39322487 (Link opens in a new window) Matsushita, T., Okada, T., Inaba, T., Mizukami, H., Ozawa...