We narrowed to 10 results for: shi

..., 156 (5), 935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki,...Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B...30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...Reviews Genetics . 16 (5), 299–311. PMID: 25854182 Shi, J., Wang, E., Milazzo, J. P., Wang, Z., Kinney, ... Replogle, J. M., Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N.,...32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., ... Cell , 46 (5), 595–605. PMID: 22521689 Yoshimi, K., & Mashimo, T. (2022). Genome editing technology and...

...23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...10.1126/science.1247005 PMID: 24336571 Shao, L., Shi, R., Zhao, Y., Liu, H., Lu, A., Ma, J., Cai, Y., ...

... VChR1 Red-shifted channelrhodopsin from Volvox carteri 570 Chronos High-speed, red-shifted channel from...Red-shifted channelrhodopsin from Tiarina fusus ; variants include rsChRmine (further red-shifted), hsChRmine...PsChR1 Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant...Stigeoclonium helveticum 500 Chrimson, ChrimsonR Red-shifted channel from Chlamydomonas noctigama ; ChrimsonR...and frChRmine (combined high speed and more red-shifted); good response with 585 nm or 650 nm stimulation...rsChRmine, frChRmine) PsChR2 High-efficiency blue-shifted channelrhodopsin from Platymonas subcordiformis...soma-targeted variant soCoChR 470 CheRiff Blue-shifted channelrhodopsin from Scherffelia dubia 460 C1C2...

...Genome Engineering, CRISPR, Mammalian Expression Takashi Yamamoto Plasmids for construction of all-in-one...TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine pFUS array vectors and destination...Platinum Gate TALEN Kit Genome Engineering, TALEN Takashi Yamamoto Plasmids for construction of highly-active...

..., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata, T., Hirabayashi...

...mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in a non-functional....org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...

...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...

...) PMID: 39322487 (Link opens in a new window) Matsushita, T., Okada, T., Inaba, T., Mizukami, H., Ozawa...