Skip to main content
Addgene
Showing: 541 - 556 of 556 results
  1. Lentiviral Guide

    Type
    Guide
    ...Can be packaged ONLY by a second generation packaging system that includes TAT Can be packaged by both...SIN) after integration. Packaging plasmid(s) Envelope plasmid Addgene’s packaging and envelope plasmids ...transfer plasmid can be packaged by either a 2nd generation or 3rd generation packaging system. For a comparison...both 2nd and 3rd generation packaging systems Packaging Plasmid All on one plasmid: Gag, Pol, Rev, Tat Two...generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging plasmid...psPAX2 . 3rd generation packaging systems: express gag and pol from one packaging plasmid and rev from another...isoforms of these packaging components. Therefore, lentivirus may not be efficiently packaged by retroviral...
  2. Retrovirus Guide

    Type
    Guide
    ...tropisms. Packaging using helper-free packaging cell lines This method utilizes a packaging cell line ...γ-Retrovirus Guide Packaging Systems Frequently Asked Questions (FAQ) Glossary γ-Retroviral Packaging Systems The...retrovirus. Packaging using 293T cells This method is very similar to lentiviral packaging methods. The...the viral packaging cell line. For example, Phoenix, a second generation γ-retrovirus packaging cell line...isoforms of these packaging components. Therefore, lentiviruses may not be efficiently packaged by γ-retroviral...below). Cloning capacity between the LTRs is ∼8.5kb, but inserts bigger than ∼3kb are packaged less efficiently...Guide to retroviral packaging systems and commonly asked questions Guides...
  3. Adenovirus Guide

    Type
    Guide
    ...increase packaging capacity E4 Essential for viral transcription; Supplied by the pAdEasy-1 packaging plasmid...these two components results in a transgene packaging capacity of >8 Kb. Constructs contain left and right...contain the viral gene E4, adding 2.7 Kb of packaging space. However, these constructs must be transfected...127 KB) . Glossary Packaging Vocabulary Term Definition pAdEasy-1 Adenovirus packaging plasmid that lacks... pAdEasy-1 packaging plasmid 911E4 cells Cell line compatible with the pAdEasy-2 packaging plasmid; Supplies...: E1 and E3. E1 is supplied by the adenovirus packaging lines 293 or 911; its deletion from the viral ...verified, the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs...
  4. CRISPR Guide

    Type
    Guide
    ...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG)... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...throughout the genome, called off-targets, that can impact your experiment. There are many online tools available...Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading and discrimination...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...further limits the packaging capacity of AAV to 2.4 kb. Methods to Increase Packaging Capacity: To increase ...increase the packaging capacity of AAV, a longer transgene may be split between two AAV transfer plasmids, the...virus (∼5%). Another technique for increasing packaging capacity depends on homologous recombination. In this...Aug;8(16):1248-54. PubMed . Expanding AAV packaging capacity with trans-splicing or overlapping vectors...and other optogenetic genes enables them to be packaged in AAVs. Click here for more information on optogenetics...indicates a virus containing the genome of serotype 2 packaged in the capsid from serotype 5. Use of these pseudotyped...
  6. Sequencing Primers

    Type
    Guide
    ...pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer...
  7. Plan Your Experiment

    Type
    Guide
    ... marker to identify and enrich positive cells Packaging and envelope plasmids provide the necessary components...particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only compatible with smaller Cas enzymes...
  8. Antibody Guide

    Type
    Guide
    ...antibodies are collected, tested against the antigen, packaged, and sold. This is the most cost-efficient way...antibodies to upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different...
  9. Science Guides

    Type
    Guide
    ...Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems,...
  10. Promoters

    Type
    Guide
    ...Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding prevents ...
  11. Optogenetics Guide

    Type
    Guide
    ...Description Peak Response Spectra (nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa ...
Showing: 541 - 556 of 556 results