Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 568 results for: PAC;

Showing: 561 - 568 of 568 results

  1. CRISPR Guide

    Type
    Guide
    ...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG)... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...throughout the genome, called off-targets, that can impact your experiment. There are many online tools available...Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading and discrimination...

  2. Plan Your Experiment

    Type
    Guide
    ...vectors is that the packaging limit (how large of a DNA sequence you can actually package into your viral ...Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system...efficiencies. The template sequences can also have a large impact on editing efficiency. So while testing multiple...promoters, and selection markers. There are also no packaging limits as there are for viral vectors — the only... Addgene's in-stock AAV preps or try Addgene's Packaged on Request service. Delivery Using mRNA and Proteins...

  3. Sequencing Primers

    Type
    Guide
    ...pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer...

  4. Modular Cloning Guide

    Type
    Guide
    ...Naomi Nakayama A toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo...between 12 and 31 repeats. Golden Gate TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine ...

  5. Antibody Guide

    Type
    Guide
    ...antibodies are collected, tested against the antigen, packaged, and sold. This is the most cost-efficient way...antibodies to upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different...

  6. Science Guides

    Type
    Guide
    ...Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems,...

  7. Promoters

    Type
    Guide
    ...Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding prevents ...

  8. Optogenetics Guide

    Type
    Guide
    ...Description Peak Response Spectra (nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa ...
Showing: 561 - 568 of 568 results