...cultures of your AAV transfer plasmid at 30 °C instead of 37 °C and then screen for ITR recombination with...flexibility since I can store the cell lysates at -80 °C for up to 6 months before purifying the AAV (Choi ...in one long day, or the virus can be stored at 4 °C and buffer exchanged the next day. Refer to the AAV...production and purification! References 1. Aurnhammer, C., Haase, M., Muether, N., Hausl, M.A., Rauschhuber...virus from the cell pellet alone. If yield is important, or if the viral particles of the AAV serotype...

...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ... ABCb10 GFP Orian Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1...Chromatin HP1 gamma GFP Tom Misteli 55068 mCherry-LaminA-C-18 Nuclear Envelope LaminA1 mCherry* Michael Davidson...cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP...

... state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced ...lentiviral vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming... Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as VP-16 transcriptional activating ...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming...retroviral expression of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction of pluripotent...

...Kalantzaki M, Gangoso E, Matjusaitis M, Garcia-Diaz C, Blin C, Grant V, Bulstrode H, Gogolok S et al. 2017. ...available for human and mouse genomes only and deals with C-terminus epitope tagging. If you work with other model...your crRNAs using other web-based design tools (for C-terminus tagging, pick a crRNA that cuts 8-15 bp downstream...site (within ~8-15 bp from the stop codon for C-terminus tagging) GC content of the crRNA (aim for 40-60%... genotyping can tell if HDR completely failed. If C-terminus tagging potentially disrupts protein function... O'Duibhir E, Quinn N, Tyrer A, Leitner MC, Plumb C, Kalantzaki M et al. 2018. An efficient and scalable...Desktop Genetics .For ssODN design, remember to incorporate PAM-blocking mutations (e.g. convert the NGG ...

...alternating between 5 min at -20°C (or -80°C) followed by 5 min at 37°C (each repeated 5 times) works well...with any protein purification, but overnight at 30°C is a good start. Prepare a lysis solution containing... PMCID: PMC4971087. 3. Simpson, David J., Jessica C. Sacher, and Christine M. Szymanski. "Exploring the...PubMed PMID: 27319741. 3. Simpson, David J., Jessica C. Sacher, and Christine M. Szymanski. "Development ...to probing with cells in order to optimize this portion of the assay before attempting it with a random...

...histidine amino acids on the N- or C- terminus of a protein. Neither the N or C terminus is preferable over ...histidine residues expressed in frame on the N- or C-terminus of a recombinant protein of interest. The...need to decide whether to add the tag to the N- or C-terminus and how many histidine residues to include...tended to be very large and often required the incorporation of a cleavage site and a post-purification cleavage...very pure sample. Because binding strength is proportional to the length of the tag, with longer tags you...

..., Kadmon, J., Raja, C., Chibukhchyan, A., Ramakrishnan, C., Inoue, M., Shane, J. C., McKnight, D. J., ...Mattis, J., Tye, K. M., Ferenczi, E. A., Ramakrishnan, C., O’Shea, D. J., Prakash, R., Gunaydin, L. A., Hyun...A., Pieper, F., Sims, R., Tenedini, F., Bergs, A. C. F., Bendifallah, I., Zhou, F., Zeitzschel, N., Ahlbeck...individual types of GPCRs with greater spatial and temporal control than is achieved by traditional pharmacologic...photoswitchable, orthogonal, remotely-tethered ligands (PORTLs). OptoXRs are chimeras of the extracellular domain...change shape with light exposure to activate them. PORTLs use a similar concept, except the ligand is attached...

... and its resolution by spatiotemporal expression profiling. Martin S, Söllner C, Charoensawan V, Adryan...series of expression vectors which have different C-terminal tags. Most vectors are based on the pTT3 ...erythrocyte invasion by Plasmodium falciparum. Crosnier C, Bustamante LY, Bartholdson SJ, Bei AK, Theron M, ...Adryan B, Thisse B, Thisse C, Teichmann S and Wright GJ Molecular & cellular proteomics 2010 Dec; 9(12):2654... of neural leucine-rich repeat receptors. Söllner C and Wright GJ. Genome biology 2009; 10(9):R99. Large-scale...extracellular protein interactions. Bushell KM, Söllner C, Schuster-Boeckler B, Bateman A and Wright GJ. Genome...protein interactions. Sun Y, Gallagher-Jones M, Barker C, Wright GJ. Analytical Biochem. 2012 May 1;424(1):...

...rise of literary giants such as Isaac Asimov, Arthur C. Clarke, James Blish, and John W. Campbell. This period...combination of the four bases of DNA – A, T, G, and C. In this movie Ethan Hawke’s character revolts against...editors (CBE) use a cytidine deaminase to introduce a C→T change at precise locations in the genome. This ...JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR (2019) Search-and-replace...Correction: Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 559:E8...420–424 . https://doi.org/10.1038/nature17946 Lenay C (2000) Hugo De Vries: from the theory of intracellular...editing technology led to the development of many important medical and agricultural products. But it also...

...window) Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K...Navarro M, Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele...Markovic M, Wolff SB, Ramakrishnan C, Fenno L, Deisseroth K, Herry C, Arber S, Lüthi A. 2016. Midbrain ...been expanded to incorporate VCre in order to enable three-feature cell targeting. C) Example of viral...processing, producing a functional molecular tool (C,F). Implementation The following resources may be ... Vcre References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu ...Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth...

... synaptic proteins Fluorescent protein system for C. elegans Fluorescent timers for studying cell cycle...native locus, but introducing large genetic changes in C. elegans with CRISPR can be difficult since it requires...can you use CRISPR to introduce large FP genes into C. elegans? By using a split FP approach. Split-wrmScarlet...together, they fuse and fluoresce. The team engineered C. elegans cell lines to express wrmScarlet1-10 unattached...grown in high concentrations of IL-3 show a high proportion of blue fluorescence, indicating cell proliferation...they could not proliferate. Eastman et al. Cell Reports 2020. https://doi.org/10.1016/j.celrep.2020.107804...

...02708-5 Hrit J, Goodrich L, Li C, et al. (2018) OGT binds a conserved C-terminal domain of TET1 to regulate...89–92. https://doi.org/10.1038/301089a0. Galonska C, Charlton J, Mattei AL et al (2018). Genome-wide tracking...https://doi.org/10.7554/eLife.34870.  Kaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming G-L, King JR...sigh. The problem is that many of these studies report correlations without clearly testing whether a ...Sapozhnikov and Szyf 2021, Charlton et al. 2020). Most importantly, TET proteins affect transcription independent...

...PMC3223083. 6. McInnes, J. L., Forster, A. C., Skingle, D. C., & Symons, R. H. “Preparation and uses of...PMC164612. 11. Liou, Y.-R., Wang, Y.-H., Lee, C.-Y., & Li, P.-C. “Buoyancy-Activated Cell Sorting Using Targeted...fusion in which AviTag is added to either the N or C terminus of the protein. BirA has been shown to effectively...of carboxyl groups to organic acids to produce important cellular metabolites. Biotin acts as a carboxyl...primary antibody respectively. Avidin bound to a reporter is then added to the reaction for easy detection... experiments. During detection, a biotinylated reporter enzyme that is pre-incubated with free avidin ...protein of interest leading to amplification of the reporter signal and easier detection. This strategy is ...

...labeling of the cell population. Figure 2: Dense (c), intermediate (d), and sparse (e) labeling of the...References: del Valle Rodríguez A, Didiano D, Desplan C (2011) Power tools for gene expression and clonal ...Feng Q, Zhou Y, Zeng S, Ren M, Jiang S, Ni H, Zhou C, Gong H, Luo M (2018) Cell-type-specific and projection-specific...was developed by Thomas Clandinin’s lab, and incorporates several common genetic tools in Drosophila (...: a method to genetically manipulate precise proportions of cells. bioRxiv 788679; https://doi.org/10.1101...

...Multi-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK...pathway in vivo . DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Taipale 87065 pcDNA3.1-ccdB-Renilla Renilla Creation of C-terminal Renilla luciferase fusions using Gateway ...Taipale 87066 pcDNA3.1-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ... 87074 pLenti6.2-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ...

...fragment of CIB1 and it was fused to both the N- and C-termini of dCas9; and 2) CRY2FL-VP64, a fusion of ...fragmented Cas9 into N-terminal (residues 2-713, N713) and C-terminal (residues 714-1368, C714) halves, rendering...split-Cas9 (FAST) system constitutively expresses the C-terminal fragment of Cas9 while transcription of the...used the bacterial phytochrome BphS which produces c-di-GMP in response to far-red light (730 nm). This...VP64 which in turn transcribes N-Cas9. The N- and C-Cas9 fragments then dimerize to form a functional ... from A. sativa (Bubeck et al., 2018). LOV2 has a C-terminal helix that unfolds when stimulated by blue...Bietz A, Waldhauer MC, Börner K, Fakhiri J, Schmelas C, Dietz L, Grimm D, Correia BE, Eils R, Niopek D (2018...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting... for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol Cell. 2016...streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen’s lab from the University...paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive channel). ...Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM, Chodera JD. bioRxiv preprint...et al. Cell. 2015. PubMed PMID: 26627737 pORTMAGE: A portable method for bacterial genome engineering ...

...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...

... L L T C G D V E E N P G P P2A: (GSG) A T N F S L L K Q A G D V E E N P G P E2A: (GSG) Q C T N Y A...ribosome skip the synthesis of a peptide bond at the C-terminus of a 2A element, leading to separation between...between the Glycine and Proline residues found on the C-terminus meaning the upstream cistron will have a ...along with a reporter, such as a fluorescence gene or a resistance gene. These reporters allow you to ...sometimes advantageous, particularly when only a portion of the plasmid is packaged for viral delivery, ...expression levels between two or more genes is important. How do multicistronic vectors work? Scientists...single transcript. The two strategies most widely incorporated into plasmids for research purposes are described...

...target sites that code for amino acids close to the C’ terminus of the protein, to maximize the chances ... absence of dsDNA breaks (Rees et al., 2018). For C>T and A>G base editors, the intended edit must be ...bystander edits are possible if there is another target C or A in the window. Another technology, prime editing...doi.org/10.1038/s41587-020-0561-9 Dempster JM, Pacini C, Pantel S, Behan FM, Green T, Krill-Burger J, Beaver...JL, De Los Angeles A, Mali P, Aach J, Kim-Kiselak C, Briggs AW, Rios X, Huang P-Y, Daley G, Church G (...sequence are important considerations for designing your gRNAs. For indels, it's not so important what location...nom. Me love gRNAs! Comic by Maya Kostman.   Important considerations before you start an experiment ...

... added to the PCR mix to remove parental DNA (37 °C for 15 mins). This enzyme specifically cuts methylated...region, with a melting temperature (Tm) of around 60 °C for all primers. The length of the homologous region...recombination. We normally use a Tm between 47-55 °C for the homologous region (calculated using Oligo ...product. For example, by combining multiple primers, a C-terminal epitope tag can be moved to the N-terminus...pathway is ubiquitous, with successful recombination reported in all laboratory E. coli strains tested so far...use of this pathway as a cloning tool was first reported over 25 years ago (Douglas and Howard, 1991, Bubeck...cloning strain has failed so far. What is most important is the transformation efficiency of the strain...

...cells. For example, Henry Lester’s lab optimized the C. elegans GluCl ion channel genes for expression in...Santana-Quintero LV, Katneni U, Simonyan V, Kimchi-Sarfaty C (2017) A new and updated resource for codon usage ...–34 . https://doi.org/10.1038/nsmb1031 Gustafsson C, Govindarajan S, Minshull J (2004) Codon bias and ...doi.org/10.1093/nar/28.1.292 Sauna ZE, Kimchi-Sarfaty C (2011) Understanding the contribution of synonymous... in a particular organism. Why is codon usage important? Translation and protein synthesis relies on transfer...deliver amino acids to the ribosome where they are incorporated into the growing polypeptide chain. One part...even been linked to some diseases. It has been reported that 5-10% of human genes contain a region where...

...J.G., Wohnoutka, P., Gerfen, C.R., Koch, C., Bernard, A., Dang, C., Jones, A.R., and Zeng, H. (2014). A ..., J. M., Vandenberghe, L. H., Haute, C. V., Thiry, I., Deroose, C. M., Mortelmans, L., Wilson, J.M., Debyser... Ravi, N., Wu, W.-L., Sánchez-Guardado, L., Lois, C., Mazmanian, S.K., Deverman, B.E., and Gradinaru, ...Winslow, B., Cain, N., Mihalas, S., Wang, Q., Lau, C., Kuan, L., Henry, A.M., Mortrud, M.T., Ouellette,... E., Tanaka, M., Kearney, M., Chattree, G., Yang, C. F., Shah, N.M., and Mooney, R. (2017). Identification...Res 406(1-2), 317-321. PubMed PMID: 2436717. Towne, C., Schneider, B.L., Kieran, D., Redmond, D.E.Jr., and... facilitate transport: retrograde transport relies on dynein, while anterograde transport relies on kinesin...

...References and Resources References Braun, C. J., Adames, A. C., Saur, D., & Rad, R. (2022). Tutorial: design...Sousa, A. A., Tsai, S. Q., Bengtsson, N. E., Lööv, C., Ingelsson, M., Chamberlain, J. S., Corey, D. P.,...M. J., Joung, J. K., Breakefield, X. O., Maguire, C. A., & György, B. (2019). High levels of AAV vector...CRISPR screens rely on lentiviral systems, a fact supported by the wide array of lentiviral-based CRISPR libraries...locations that could cause deleterious effects. It is important to note, however, that while AAV rarely integrates..., CRISPR may increase this rate. Specifically, portions of the AAV genome can integrate at double-stranded...

...resistance, b) the promoter that drives the insert, and c) any other selection markers (for use in other cell...pBACKBONE-Flag-hGene If there was also an EGFP fused to the C-terminal of your insert you would list it after the...identify what your plasmid contains and other important information. Tip: A lowercase "p" is often used...simple piece of information can often convey many important details. Once you know the backbone a plasmid ...

... Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019). ..., X., Chen, W., Martin, B. K., Calderon, D., Lee, C., Choi, J., Chardon, F. M., McDiarmid, T. A., Daza...Kissling, L., Marquart, K. F., Schmidheini, L., Solari, C., Balázs, Z., Krauthammer, M., & Schwank, G. (2023...-024-02268-2 Schep, R., Brinkman, E. K., Leemans, C., Vergara, X., van der Weide, R. H., Morris, B., van... In our study, we used the TRIP (Thousands of Reporters Integrated in Parallel; Akhtar et al., 2013; Schep...Chromatin Position Effects Assayed by Thousands of Reporters Integrated in Parallel. Cell, 154(4), 914–927....

....1126/science.abb2920 Vo PLH, Ronda C, Klompe SE, Chen EE, Acree C, Wang HH, Sternberg SH (2020) CRISPR...and require only two transposase proteins (TnsB and C). While requiring fewer components for RNA-guided ...Rubin BE, Diamond S, Cress BF, Crits-Christoph A,  He C , Xu M, Zhou Z, Smock DC, Tang K, Owens TK, Krishnappa...genomes engineering In the Sternberg group’s initial report of VchINT, three separate plasmids and multiple...simple to use, users should keep aware of a few important details. For transposons to be specifically recognized...

...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...preparations are then aliquoted, frozen, and stored at -80 °C. Concentrated lentiviral preparations (“-LVC” catalog...expression and/or function. These data are sometimes reported or posted on the material page for the corresponding...recipient’s initial thaw will be accounted for in our reported titers. Lentiviral vectors are titered using a...

...Epitope tags are short peptides introduced at the N or C terminus of a protein that are bound by antibodies...enterokinase, which recognizes the 5 amino acids on the C terminal of the tag. Of the most common tags, FLAG...not at all. The introduction of a tag at the N or C terminus of a protein may disrupt the biological function...destabilization can be brought about by the tag so it’s important to validate tagged protein functionality (Arribere...

...please sign up here.        New toolkit for N or C terminal tagging of proteins for degradation using...has created a new toolkit of plasmids for the N- or C- terminal tagging of proteins with mAID and other ...cytidine deaminase  Target-AID-NG, which mediated a C to T conversion in the target sites adjacent to an...Earlier this year, the Hegemann lab and collaborators report their discovery of a new family of seven ChRs derived...