Skip to main content
Addgene

We narrowed to 148 results for: GFP reporter gene

Showing: 101 - 148 of 148 results
  1. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for... Lentiviral reporter vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing...Lentiviral dual reporter vector expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST... expressing destabilized EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly...pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing firefly luciferase and ZsGreen...Addgene's collection of plasmids for viral pseudotyping with SARS-CoV-2 spike protein. Collections...the live virus. Alternatively, it is possible to generate pseudovirus, where the structural and functional...
  2. Worm Expression Resources

    Type
    Collection
    ...briggsae , etc.) gene or sequence: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great...can knock down genes by feeding worms bacteria expressing dsRNA or use CRISPR/Cas9 gene editing to easily... used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert PI Plasmids Expressing...which diminishes epigenetic silencing in the germline. A "FLP-Out" system for controlled gene expression in...elegans genome is well studied and hundreds of reporters have been developed and characterized which allow...Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...
  3. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...into contact with than GFP. Similarly, if the viral vector carries an shRNA to a gene essential for cellular...looks like the genetic cargo in one plasmid (the transfer plasmid), the envelope (Env) gene on a separate...with those particles. Since the Env, Gag, and Pol genes are not encoded in the transfer plasmid, the component...familiarize yourself with your organization’s reporting mechanisms before you start an experiment, just...Resources Resources on Addgene.org Addgene viral services Addgene Biosafety Guide Addgene Viral Plasmids ...? That’s okay! In this article we will discuss general viral safety considerations and best practices ...of what is being integrated by the virus. If an oncogene overexpression construct is being delivered, that...
  4. Biosensor AAV Preps

    Type
    Collection
    ...pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn...9 Li Voltage Reporter: Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent...Syn Archon1 EGFP Cre dependent 8 Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn...Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter: JEDI-2P 179459 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE ...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1, 9 Schreiter Dopamine Sensors...Ready-to-use AAV available from Addgene's viral service encoding biosensor tools, including calcium sensors...
  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...
  6. Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

    Type
    Blog Post
    ...excised by Cre recombinase. Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression...investigation into the regulation of your favorite gene. But have no fear - I’m here to introduce you to...sigh. The problem is that many of these studies report correlations without clearly testing whether a ...genome – could be affected, leading to unpredicted gene expression changes (Sapozhnikov and Szyf 2021, Charlton...interact with transcriptional machinery to modify local gene expression, confounding any potential conclusions...causal relationship between DNA demethylation and gene expression (Sapozhnikov and Szyf 2021).    ... expressing blasticidin or puromycin resistance genes.  It’s that simple! Good luck and happy editing...
  7. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ...labeling. Size is also a factor. Bulkier tags, such as GFP, may interfere with protein expression or function...ligands for dopamine D2/D3 receptors. Scientific Reports, 10(1). https://doi.org/10.1038/s41598-020-78827...fluorescence-based ligand-binding assay. Scientific Reports, 6. https://doi.org/10.1038/srep25769 Grimm, J....mitochondrial dynamics in mammalian cells. Biophysics Reports, 3(4–6), 64–72. https://doi.org/10.1007/s41048-...the dye and the endogenous target, and thus no genetically encoded tag is required. These dyes can also ...be SNAP-tag® and HaloTag®. These consist of a genetically encoded enzyme variant tag that covalently reacts...maintained through mechanisms like fission, fusion, biogenesis, and mitophagy, can be tracked using dyes like...
  8. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

    Type
    Blog Post
    ...contain a toxin gene (regulated by a rhamnose-inducible promoter) and a chromoprotein gene. Allelic exchange...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...the plate. For example, if your plasmid contains a gene encoding a blue chromoprotein, after transforming...3: pTOX plasmids expressing amilCP and tsPurple genes. Image: Lazarus et al., 2019. One such lab is...improved expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604...protein family. What sets them apart is the way they generate their color: they strongly absorb visible light...difficult to directly use in bacteria, where most genetic manipulations start. Anthony Forster’s lab used...
  9. COVID-19 Resources

    Type
    Collection
    ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...top Plasmids Encoding Mammalian Genes or Inserts Several mammalian genes have been identified as having...to these genes below. ID Plasmid Description Industry PI For more information on these genes, see the ... lists several luciferase and fluorescent reporter plasmids that have been used for measuring viral entry...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...
  10. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...depending on its orientation to your gene. T7lac High levels of gene expression Promoter from T7 bacteriophage...modulating gene expression through varied inducer concentrations. trp High levels of gene expression...human or mouse) General expression mRNA Mammalian promoter from phosphoglycerate kinase gene.  Constitutive...deacetylation. Ubc General expression mRNA Mammalian promoter from the human ubiquitin C gene Constitutive  ... human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive  Ubiquitous... Requires the presence of Gal4 gene to activate promoter. Ac5 General expression mRNA Strong insect ...Actin 5c gene Constitutive  Commonly used in expression systems for Drosophila. Polyhedrin General expression...
  11. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type
    Blog Post
    ...the ccdB gene is replaced by the gene of interest. As a result, cells that retain the ccdB gene die off...tool. The plasmid pKSCTMF contains the mazF gene and a gene for Zeocin resistance (Figure 2). This MazF-ZeoR...The team used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed mutations...antisense RNA regulates hok gene expression indirectly through the overlapping mok gene." Journal of molecular...associated genes. These systems better ensure that plasmids are passed down through generations (Figure ...application of CcdB is GatewayTM cloning, where the ccdB gene serves as a counterselectable marker in the destination...they tested a lux-mediated bioluminescence reporter in vivo in the absence of selective pressure and found...
  12. Avoiding the Dark Side of Fluorescent Protein Fusions with mOX FPs

    Type
    Blog Post
    ...potentially affect function [5]. We and others have reported that FP cysteine residues form inappropriate disulfide...negative bacteria periplasm. Efforts to tag endogenous genes for proteins in these compartments using CRISPR ...tagging to detect proteins expressed from cloned genes: deletion mapping functional domains of Drosophila...Lindsey M. Costantini, and Erik L. Snapp. "Superfolder GFP is fluorescent in oxidizing environments when targeted...quantitative imaging experiments and cell physiology in general. Pitfalls of Fluorescent Protein Fusions Observing...cellular compartments other than the cytoplasm. Generally, FPs evolved in or were engineered for use in ...N-glycosylation consensus sequences in popular FPs. This generated a palette of inert green, cyan, yellow, and blue...
  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...an unpublished set of Zika gene plasmids to Addgene’s repository. The genes, from the Zika virus Asian...vectors targeting their genes of interest to generate mAID fusions to endogenous genes. Cell lines with the...targeting a total of 20,121 genes within the human genome (the identity of the genes and target sequences can...expression level for their gene of interest. Although the parts involved in altering gene expression are relatively...promoters and 140 genes, including constructs with unique tissue-specific promoters expressing GFP, tetracycline...contains ~90,000 gRNAs that target ~15,000 genes with 6 gRNAs per gene. The second is a "supplementary" library...library to generate a population of HEK293FT cells expressing a single gRNA targeting a single gene. The gRNA...
  14. The Challenges of Cell Culture

    Type
    Blog Post
    ...about the Dangers of Using GFP for Protein Localization Resources on Addgene.org Find Plasmids for Mammalian...been known about since 1966 when Stanley Gartler reported that most of the 18 cell lines he had studied ...pharmacology (many of which are represented in Addgene's Special Collections). Arguably, oncology has benefited...examining whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique...out by the commercial repository. Repositories generally ensure cell line identity and purity making it...to the original as possible and so any results generated are reproducible and reliable. When you order ...Abcam Cell Culture Guidelines Resources on the Addgene Blog Learn All about Mammalian Vectors Read up...
  15. Tetracycline Inducible Expression

    Type
    Collection
    ...promoter upstream of your gene of interest. If your gene of interest should be generally active and only turned...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Tet-On Systems for Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org...Tet-On system for regulated gene expression through viral evolution . Gene Ther, 13 (19), 1382–1390. https...downstream gene via its activation domain than simply removing the repressor. 2nd and 3rd Generation Systems...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...
  16. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...phosphatase-positive assay) as well as stabilization (Nanog-GFP reporter activation and silencing of factor-linked mCherry...understanding of B. subtilis gene functions and interactions. The single-gene deletion library is derived...studying the phenotype of an essential gene, the CRISPRi Essential gene Knockdown library was constructed ... in this work are available at Addgene. Kim, et al. Stem Cell Reports. 2015. PubMed PMID: 25772473 ...elements and combined it with a variety of reporters (i.e. eGFP) and effectors (i.e. DREADDs). The team ...Bacillus subtilis libraries with Addgene – the B. subtilis Single Gene Deletion Library—Kanamycin and the...their useful reagents shared via Addgene. Narayan S, et al. Cell Reports. 2017. PubMed PMID: 28813671 ...
  17. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    ...ACE) in real-time. The reporter constitutively expresses eGFP to indicate reporter abundance, and mCherry...quantifying multiple gene editing activities. Click here to find the ACE reporter plasmid! Martin et al...and N177F mutations). Its excitation maximum is reported as 603 nm, while the emission maximum is 675 nm... ACE system: A versatile in vivo fluorescent reporter for rapid quantification of base-editing and Cas9...editing tools, the Reuben Harris lab has deposited a reporter plasmid that allows for rapid fluorescence-based... out a frame-shift mutation within the mCherry reporter. Quantification of editing efficiencies simply...containing rat APOBEC1. Finally, they show that the ACE reporter can also quantify Cas9 cleavage, thus exhibiting...
  18. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...comprised of OCT4, SOX2, LIN28, NANOG, and a GFP reporter. Minicircles are removed from cells by dilution...started the field of iPSCs Find gene-specific plasmids (including reporters and RNAi) for:  NANOG  OCT4 ...reprogramming transgenes and the up-regulation of corresponding endogenous pluripotency genes. Retroviral...disrupt the expression of tumour suppressor genes and/or oncogenes, potentially leading to the presentation... Shao, L., & Wu, W. (2010). Gene-delivery systems for iPS cell generation. Expert opinion on biological...high is based on the reprogramming efficiencies reported in González et al. A percentage is not listed ...a single polycistronic vector or multiple single-gene vectors can be used to package reprogramming factors...
  19. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...growth as RNA biology, we are looking forward to reports on the next additions to aptamer soup! References...If you’re been following Addgene on #souptwitter or if you just enjoy a warm meal on a winter day, you...molecule into the cell. The fluorescence that is generated allows for qualitative and quantitative measurement...placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the... we’ll take a deeper dive into the content of Addgene’s aptamer soup by exploring the development and ...and applications of fluorescent RNA aptamers in Addgene’s collection. Green fluorescent aptamers Spinach...
  20. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Utilization During Gene Targeting with Zinc-Finger Nucleases. G3 Genes Genomes Genetics, 3(4), 657–664. ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...Jaenisch, R. (2013). One-Step generation of mice carrying mutations in multiple genes by CRISPR/CAS-Mediated ... & Jaenisch, R. (2013). One-Step generation of mice carrying reporter and conditional alleles by CRISPR...example, choosing target sites that span the knock-in gene. For making mutations, one good way is to mutate...be okay if you are introducing a selection marker gene. The homology arms should be no more than 100 bp...for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper ...
  21. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...possible deletion strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located...evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene 7,8 . To evaluate the protein, perform...genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple... as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin...for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...transfection conditions for each cell line with a reporter construct to ensure robust plasmid delivery before...
  22. Zebrafish Plasmid Collection

    Type
    Collection
    ...zebrafish gene of interest? Search Addgene's collection for plasmids that contain a zebrafish gene or sequence...control of gene expression in zebrafish using red light. LipoGlo - Steven Farber Lab. A reporter system that...zebrafish-specific gene expression database that provides information about when genes are active in developing...developing embryos. zfRegeneration - A database for gene expression profiling during regeneration. Seurat - R ...-type specific conditional gene inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration...ranging from optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard... finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart research model...
  23. Validated gRNA Sequences

    Type
    Collection
    ...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...
  24. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter...vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious virus...the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter ... 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...
  25. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ...along with a reporter, such as a fluorescence gene or a resistance gene. These reporters allow you to easily...you could replace one of the reporter genes above with your gene or genes of interest. Some of the plasmids...the reporter gene). Addgene's collection offers a variety of plasmids to express two or more genes, some... that are expressing your gene, especially if you are studying a novel gene, is not always a straightforward... your gene of interest, scientists have instead developed novel methods to co-express your gene along ...express more than two genes at a time using IRES elements. Further, scientists have reported lower expression...multicistronic element and reporter cloned in. In these plasmids you would simply clone your gene of interest into...
  26. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...ten colors (see table to the right); in various reports, Sanes and Lichtman have observed from 90-160 distinct...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...
  27. Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus

    Type
    Blog Post
    ...Figure 1). All viral genes are removed and replaced by a single (non-viral) reporter gene (e.g. firefly luciferase...transcribe the reporter gene (e.g. firefly luciferase). The polymerase recognizes the gene start signal ...transcription of the reporter gene. The polymerase will elongate the mRNA until it reaches the gene end signal,...luciferase or eGFP) flanked by the EBOV-specific gene start and gene end sequences. Thus, the minigenome...replication and viral gene transcription (6). The EBOV genome contains seven viral genes, each flanked by ...sequence (gene start) and a transcription termination/polyadenylation signal sequence (gene end). A minigenome...necessary to direct minigenome replication and reporter gene transcription by the EBOV polymerase (reviewed...
  28. TALEN Engineering

    Type
    Collection
    ...Endogenous Zebrafish Genes TALENs for Endogenous Human Genes TALENs for the EGFP Reporter Gene Additional Plasmids...transcriptional activator target sites and then generates individual user-friendly graphical roadmaps for...
  29. Special Delivery: Fluorophore Targeting for FRET Studies

    Type
    Blog Post
    ...protein, permeabilized cells  Cy5NTAc 32 25-45 GFP (fluorescein is similar)   Lumio Red Tc: CCPGCC 48...protein kinase dynamics in living cells with FRET reporters." Methods 40.3 (2006): 279-286. PubMed PMID: 16908183...in setting up a FRET-based assay or screen (the Addgene blog has an excellent primer on FRET and how to...Fluorescent proteins (FPs) are the gold standard for genetically-encoded FRET donors (Fig. 1). Scores of FP variants...presented (Fig. 1) which can be carried out using Addgene plasmids. His-tag labeling reagents You may already...Gradia Lab has deposited a gateway vector with Addgene, where you can insert your protein of interest,...PubMed Central PMCID: PMC4380784. Resources on the Addgene Blog Get Tips for Using FRET in Your Experiments...
  30. Adenovirus Guide

    Type
    Guide
    ... contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest. With...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...
  31. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...other labs have reproduced their EGFP findings since the initial report in 2023.)     Figure 1:...Andrew and Maria were encouraged by previous reports that described magnetic responses of cryptochrome ...magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random mutagenesis and screening.../nn.4265.  Additional resources on addgene.org Find Optogenetics Plasmids Find Biosensor Plasmids Visit... al., 2024). They deposited their plasmid with Addgene, hoping to inspire others to explore the phenomenon...Although a wide range of fluorescent proteins and optogenetic tools exist, humans (like many organisms) are...magnetoresponsive fluorescent protein. Controlling an optogenetic or fluorescent tool with magnets would enable...
  32. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...a gRNA designed to target a mutated gene. In a Scientific Reports paper introducing the delivery method...been used for many years for in vivo delivery and gene therapy and represent one of the most studied viruses...CRISPR-Cas. Figure 1: Schematic of targeted gene knock-out (left) and targeted DNA knock-in (right...binds to target DNA. In the final step of targeted gene knock-out (left), a fragment is deleted from two... This capacity is large enough to carry the Cas9 gene and a gRNA expression cassette in one single viral...Joining (NHEJ) DNA repair mechanism to knock out genes as a result of an insertion, a deletion or a frameshift...method in 2014, Manuel Goncalves lab report that AdV-mediated transduction of gRNA:Cas9 ribonucleoprotein...
  33. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ...measurable through an epitope tag such as FLAG/His/GFP. Fluorescent protein tags, which correlate closely...procedure and application to the major ALS/FTD disease gene C9ORF72. eLife, 8, e48363. https://doi.org/10.7554... specific detection of human TRPA1. Scientific Reports, 9(1), 18500. https://doi.org/10.1038/s41598-019...101: Validation Resources on addgene.org Addgene's Antibody Guide Addgene's Antibody Protocols... outlined below. Knockout cell line approach Genetic knockout-based validation can conclusively prove...you are working with cells that are amenable to genetic knockout, this represents a very robust approach...to start with a screening procedure in easily genetically modified cell types (top). The specific approach...
  34. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...services collection or check out Addgene's Data Hub to see viral vector reports from other users. And don't...promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5 preparations...variants of a new optogenetic tool called PdCO, deposited by the Yizhar lab. Addgene is now offering AAV1... pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics Yizhar New viral service with...AAV1, AAV5 Optogenetics Yizhar New viral service with multiple serotypes pAAV_hSyn-PdCO-EGFP-WPRE AAV1... Brian O'Neill.  More resources on the Addgene blog Addgene's Data Hub What is a Virus (and a Viral Vector...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...
  35. New Viral Vectors - March 2024

    Type
    Blog Post
    ...services collection or check out Addgene's Data Hub to view viral vector reports from other users. And don't...AAV9 Optogenetics Adesnik New viral vector pAAV-nEF-Con/Foff DREADD Gi-mCherry AAV8 Chemogenetics Deisseroth... pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype pAAV-CaMKIIa-EGFP AAV PHP.eB Controls...latest in Addgene's viral vectors services and resources!   More resources on the Addgene blog Addgene's...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...Table 1: New ready-to-use viral vectors in the Addgene repository  Name Serotype Category Depositor...Deisseroth New viral vector pAAV.CMV.PI.EGFP.WPRE.bGH  AAV PHP.eB Controls Wilson New viral vector ...
  36. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...
  37. CRISPR Guide

    Type
    Collection
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
  38. Hot Plasmids and Viral Preps - July 2021

    Type
    Blog Post
    ...for doing gene targeting, reporter generation, controllable gene knockouts, and inducible gene inactivation...Alec Kimmelman targets mouse metabolic genes with ~6 gRNAs per gene.  CRISPR-Act3.0, developed by Yiping... Shirley Liu's lab targets all mouse genes with 10 gRNAs per gene. The guides are optimized to maximize... to develop CRISPR-based approaches for studying gene function in these systems. As a part of this effort...Yiping Qi's lab, allows simultaneous gene activation in plants.  FnCas12a, unlike other Cas12a nucleases identified...opportunities for investigating genetic mechanisms related to morphogenesis, cell fate specification, and...Lab have compiled a new toolkit for performing genetics studies in organoids. The Organoid EasyTag System...
  39. Lentiviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal repeats...shRNA , and overexpressing of oncogenes and other disease-associated genes. Gene Therapy Due to their relative...complex genomes, containing packaging genes and accessory genes specific to each virus type, while retroviruses...require the regulatory genes tat and rev , along with virus-specific accessory genes (for example, vif , ...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...
  40. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

    Type
    Blog Post
    ...research. But be aware that the fluorescent proteins reported in publications are only characterized under a...victoria, AvGFP forms a homodimer. In corals, the red fluorescent proteins form tetramers. In general, fluorescent... develops genetically encoded FRET based biosensors.     Additional Resources on the Addgene Blog Which...detect weak dimerization tendency, as is present in EGFP. Constantini et al, (2012) developed a cell-based... properties of new fusions can be compared with mEGFP or mTurquoise2, which are established true monomeric...Amsterdam). He develops, characterizes and uses genetically encoded fluorescent probes. You can follow him... Protein Biosensors Additional Resources on Addgene.org Find Empty Backbones with Fluorescent Tags Find...
  41. Molecular Biology Reference

    Type
    Guide
    ...elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the...bacterial populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin...transcription. Gene Knock-down Plasmids - Used for reducing the expression of an endogenous gene. This is frequently...check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic elements...chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists can easily...easily study and manipulate genes and other genetic elements using specifically engineered plasmids, commonly...when a gene is inserted within the MCS, its expression will be driven by the promoter. As a general rule...
  42. A Practical Approach to Choosing the B(right)est Fluorescent Protein

    Type
    Blog Post
    ...of posts explains how to critically assess the reported properties of fluorescent proteins, how to do ...observed in mammalian cells is to tag an endogenous gene. By imaging cells (or tissues) that produce an endogenous...fluorescent proteins or using endogenous tagged genes) can be used to verify performance under different... develops genetically encoded FRET based biosensors.     Additional Resources on the Addgene Blog Which... QY (EC*QY, sometimes normalized to the value of EGFP). The higher the number, the higher the theoretical...mVenus as a reference protein is available from Addgene. Another way to dodge cellular variation observed...Amsterdam). He develops, characterizes and uses genetically encoded fluorescent probes. You can follow him...
  43. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ... this gene. Should you cut it at the beginning of the coding sequence to delete the entire gene? Perhaps... in vitro, and using it in mouse embryos to generate gene modified mouse lines. Hopefully this post will...they have been generated (more on that later). Find Validated gRNAs to Target Mouse Genes To begin the ...chances of gene modification in vivo. Find Plasmids for Testing Your gRNAs in vitro at Addgene CRISPR/Cas9...decide to do a gene modification experiment in mice to the day you have your F0 generation (barring life...Haoyi, et al. "One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated ...blogger Samantha Young. The use of CRISPR/Cas9 for gene editing has expanded since its adaptation for use...
  44. Optogenetics Guide

    Type
    Guide
    ...opsins and optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium ...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...pDusk Blue-light photoreceptor for light-controlled gene expression. These plasmids rely on the engineered... Science Guides Optogenetics Guide Optogenetics Guide Jump To: Optogenetics Guide Introduction Microbial...Collection . To find optogenetics plasmids available through Addgene, check out our Optogenetics Plasmid Collection...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...References Introduction The field of optogenetics integrates optics and genetic engineering to measure and manipulate...
  45. The Pleiades Promoter Project

    Type
    Collection
    ...MiniPromoter Source Gene Construct Reporter Negative Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308... disorders by enabling region- and cell-specific gene-delivery in the mouse brain through these human ...pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306 EGFP/NLS N/A pEMS1307 EGFP/NLS N/A pEMS1313 intron-lacZ...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...
  46. CRISPR Guide

    Type
    Guide
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
  47. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

    Type
    Blog Post
    ... Figure 1: In conventional gene targeting (A), you must first generate your desired mutation in mouse...References Yang, Hui, et al. "One-step generation of mice carrying reporter and conditional alleles by CRISPR...mutations, the 8-10 month process of conventional gene targeting is lowered to about 2-3 months. But certain...example of inserting a 2A-FlpO cassette into the Fgf8 gene. Miura et al. (2018) suggest using a 50-80 bp sequence... mouse model generation easi-er! Generating mice before CRISPR The process of generating knock-in mice...process of mouse model generation simpler, as described in an earlier post on generating CRISPR mouse models...after editing. How to use Addgene plasmids for Easi-CRISPR You can use Addgene plasmids to create a repair...
  48. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...in neurons. (b) Genetic cargo can be customized to control transgene expression. Gene regulatory elements... relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the....     Figure 1: AAV toolkit for targeted gene delivery to the brain. The AAV (a) capsid, (b) cargo...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. ...Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nature Protocols;14, 379–414...2017). Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems...Gradinaru, V. (2022). Engineered AAVs for non-invasive gene delivery to rodent and non-human primate nervous...
Showing: 101 - 148 of 148 results