We narrowed to 298 results for: IRES

...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...

...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse...

...times when you may be working with a protocol that requires shaking or mixing, which may produce aerosols ... PPE protocols . Working in a BSL-2 laboratory requires laboratory glasses in addition to coat and gloves...

...to the template DNA and the Taq polymerase, PCR requires free nucleotides [dNTPs; adenine (A), cytosine... thymine (T)] in an equal molar ratio. It also requires two unique single stranded DNA oligonucleotide...

...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV...

... ∼500 ng of DNA, while molecular cloning often requires 1 µg of DNA. The total reaction volume usually...

...cell lines and selection markers. Note this assay requires staining resistant colonies with crystal violet...

...enough master mix for all samples). Each sample requires 15 μL of master mix. Pro-Tips Use a "Universal...

...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...improve HDR efficiency . Remember that HDR also requires donor DNA to serve as template for the repair....: Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional activators...

...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

... H2B mRFP Bryan Welm , Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-Tubulin ...

...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...

...gRNA and Cas gRNA Only Multiplex Resources CRISPR requires you to express both a Cas protein and a target-specific...

...Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 ...

...17. PubMed . Description Use of the OPEN method requires OPEN pools (available by request from the Joung...

...crRNA/gRNA length gRNA: ~100 nt crNA: ~42 nt Requires tracrRNA? Yes No dsDNA cleavage Blunt end 5'...vector expresses Cas9 and up to 7 gRNAs Each gRNA requires its own promoter Sakuma et al   Multiplexed...expresses Cas9, eGFP, and up to 4 gRNAs Each gRNA requires its own promoter   Kabadi et al Csy4-Cleavable...gRNAs expressed from a polycistronic transcript  Requires co-transfection of Cas9 Nissim et alTsai et al...gRNAs expressed from a polycistronic transcript Requires co-transfection of Cas9   Xie et al  Multiplexing...

...binding sites, commonly used in Drosophila Specific Requires the presence of Gal4 gene to activate promoter...Promoter from T7 bacteriophage Constitutive, but requires T7 RNA polymerase. When used for in vitro transcription... Negligible basal expression when not induced. Requires T7 RNA polymerase, which is also controlled by...Promoter from Sp6 bacteriophage Constitutive, but requires SP6 RNA polymerase. SP6 polymerase has a high ...Promoter from T3 bacteriophage Constitutive, but requires T3 RNA polymerase When used for in vitro transcription...

...expression from that element. When this activation requires a transcription factor to bind to a small molecule...

...materials. Problems with Chip-seq ChIP-seq typically requires a large amount of input material, cells or tissue...experiment can be a major technical hurdle.   ChIP-seq requires  cross-linking during an initial fixation step...wing as a model. A typical ChIP-Seq experiment requires around 1,000 wings. Collecting that much tissue...controlled by the addition of calcium, which MNase requires for its nuclease activity and is chelated from...