Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 298 results for: IRES

Showing: 41 - 60 of 298 results

  2. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...

  3. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...times when you may be working with a protocol that requires shaking or mixing, which may produce aerosols ... PPE protocols . Working in a BSL-2 laboratory requires laboratory glasses in addition to coat and gloves...

  4. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...to the template DNA and the Taq polymerase, PCR requires free nucleotides [dNTPs; adenine (A), cytosine... thymine (T)] in an equal molar ratio. It also requires two unique single stranded DNA oligonucleotide...

  5. Adenovirus Guide

    Type
    Guide
    ...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV...

  7. Colony Formation Titering Assay

    Type
    Protocol
    ...cell lines and selection markers. Note this assay requires staining resistant colonies with crystal violet...

  9. Plan Your Experiment

    Type
    Collection
    ...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...improve HDR efficiency . Remember that HDR also requires donor DNA to serve as template for the repair....: Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional activators...

  10. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin ...

  12. CRISPR Guide

    Type
    Collection
    ...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

  13. Antibody Guide

    Type
    Collection
    ...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...

  16. Chemogenetics Guide

    Type
    Guide
    ...window) Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al. (2009). A chemical-genetic approach...

  18. Bacterial Expression Systems

    Type
    Collection
    ...expression from that element. When this activation requires a transcription factor to bind to a small molecule...

  19. Multiplex Genome Editing with CRISPR-Cpf1

    Type
    Blog Post
    ...crRNA/gRNA length gRNA: ~100 nt crNA: ~42 nt Requires tracrRNA? Yes No dsDNA cleavage Blunt end 5'...vector expresses Cas9 and up to 7 gRNAs Each gRNA requires its own promoter Sakuma et al   Multiplexed...expresses Cas9, eGFP, and up to 4 gRNAs Each gRNA requires its own promoter   Kabadi et al Csy4-Cleavable...gRNAs expressed from a polycistronic transcript  Requires co-transfection of Cas9 Nissim et alTsai et al...gRNAs expressed from a polycistronic transcript Requires co-transfection of Cas9   Xie et al  Multiplexing...
Showing: 41 - 60 of 298 results