We narrowed to 299 results for: IRES
-
TypeBlog Post...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...
-
Sequencing Primers
TypeGuide...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol...times when you may be working with a protocol that requires shaking or mixing, which may produce aerosols ... PPE protocols . Working in a BSL-2 laboratory requires laboratory glasses in addition to coat and gloves... -
What is Polymerase Chain Reaction (PCR)
TypeProtocol...to the template DNA and the Taq polymerase, PCR requires free nucleotides [dNTPs; adenine (A), cytosine... thymine (T)] in an equal molar ratio. It also requires two unique single stranded DNA oligonucleotide... -
Adenovirus Guide
TypeGuide...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV... -
Molecular Biology Protocol - Restriction Digest of Plasmid DNA
TypeProtocol... ∼500 ng of DNA, while molecular cloning often requires 1 µg of DNA. The total reaction volume usually... -
Colony Formation Titering Assay
TypeProtocol...cell lines and selection markers. Note this assay requires staining resistant colonies with crystal violet... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...enough master mix for all samples). Each sample requires 15 μL of master mix. Pro-Tips Use a "Universal... -
Plan Your Experiment
TypeCollection...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...improve HDR efficiency . Remember that HDR also requires donor DNA to serve as template for the repair....: Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional activators... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin ... -
CRISPR Guide
TypeCollection...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites... -
Antibody Guide
TypeCollection...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody... -
Chemogenetics Guide
TypeGuide...window) Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al. (2009). A chemical-genetic approach... -
Brzezinski Lab CRISPR Collection
TypeCollection...Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 ... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...17. PubMed . Description Use of the OPEN method requires OPEN pools (available by request from the Joung... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...toward expanding this capacity. Traditionally, AAV requires the presence of another "helper" virus, such as... -
Bacterial Expression Systems
TypeCollection...expression from that element. When this activation requires a transcription factor to bind to a small molecule... -
Multiplex Genome Editing with CRISPR-Cpf1
TypeBlog Post...crRNA/gRNA length gRNA: ~100 nt crNA: ~42 nt Requires tracrRNA? Yes No dsDNA cleavage Blunt end 5'...vector expresses Cas9 and up to 7 gRNAs Each gRNA requires its own promoter Sakuma et al Multiplexed...expresses Cas9, eGFP, and up to 4 gRNAs Each gRNA requires its own promoter Kabadi et al Csy4-Cleavable...gRNAs expressed from a polycistronic transcript Requires co-transfection of Cas9 Nissim et alTsai et al...gRNAs expressed from a polycistronic transcript Requires co-transfection of Cas9 Xie et al Multiplexing... -
Plasmids 101: The Promoter Region – Let's Go!
TypeBlog Post...binding sites, commonly used in Drosophila Specific Requires the presence of Gal4 gene to activate promoter...Promoter from T7 bacteriophage Constitutive, but requires T7 RNA polymerase. When used for in vitro transcription... Negligible basal expression when not induced. Requires T7 RNA polymerase, which is also controlled by...Promoter from Sp6 bacteriophage Constitutive, but requires SP6 RNA polymerase. SP6 polymerase has a high ...Promoter from T3 bacteriophage Constitutive, but requires T3 RNA polymerase When used for in vitro transcription...