We narrowed to 93 results for: IRES-GFP
-
TypeBlog Post... to track where GFP labelled B cells were in mounted slices of these organs. These GFP labelled cells ...enabled by fluorescent proteins The optimization of GFP and its derivatives by the late Roger Tsien changed...stimulus. Using an epifluorescence microscope and GFP fusion proteins controlled by promoters specific ...the immune lineage, scientists could easily track GFP expressing cells. For example, by harvesting lymph... the infiltration of neutrophils expressing LysM-GFP (green) into a draining lymph node after infection...Laser include: Blue-green fluorescent proteins like EGFP Yellow-orange fluorescent proteins like TagRFP, ...auto-fluorescence (Drobizhev et al. 2011). But this requires other lasers than the standard Ti:Sapphire laser...
-
Choosing Your Fluorescent Proteins for Multi-Color Imaging
TypeBlog Post...imaging with this set are mTagBFP2, EGFP or one of the improved GFP variants, mRuby2 or TagRFP-T, and an... / em 527 nm) can be imaged together but CFP and GFP (ex 488 nm / em 507 nm) show some crosstalk between...simultaneously. To do so with fluorescent protein labels requires multiple fluorescent proteins whose excitation... means that the choice of fluorescent proteins requires some thought. The first step in choosing fluorescent...fluorescent proteins can be separated from each other requires knowledge of their excitation and emission spectra...mammalian cells, one of the improved folding variants of EGFP like mEmerald or Clover is probably best; mNeonGreen...and have reported brightness measurements. Here, EGFP outperforms the improved folding variants, presumably... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...monoclonal antibodies against them, fused them to GFP, and compared them to popularly used epitopes tags... -
Visualizing Genomic Loci with CRISPR-Sirius
TypeBlog Post...each recruits a different fluorescent protein (BFP, GFP, or RFP) to the genomic loci of interest. Pairs of...hairpin sequence (sgRNA-Sirius-8XPP7) to recruit GFP to the loci of interest. To determine how the sgRNA-Sirius...different chromosomes in living cells, the system requires high-copy chromosome-specific loci in the genome... -
Antibodies 101: Single Chain Fragment Variables (scFvs)
TypeBlog Post...binding scFv that’s fused to GFP. When the multiple copies of the scFv-GFP fusion bind the SunTag scaffold...scFv that’s fused to a fluorescent protein such as GFP. The HA frankenbody works just like an antibody-based...for the scFv (Gaciarz and Ruddock., 2017), but requires an oxidizing environment to form. When expressed... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...vector expressing firefly luciferase. pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing...mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral vector... a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the live...vector expressing destabilized EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly... -
Hot Plasmids - February 2022
TypeBlog Post...anti-FLAG-FB-GFP binding to FLAG-tag H2B for nuclear localization. (c) Applications of anti-FLAG-FB-GFP labeling...This set of new anti-FLAG frankebodies includes mEGFP, mRuby2, iRFP713, SNAP-tag, and HaloTag fusions,...fusions, while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG...label your favorite protein! While the target only requires a small epitope tag (FLAG is eight amino acids... -
Stabilized Bacterial Promoters: Constant Gene Expression at any Copy Number
TypeBlog Post... constitutive promoter upstream of GFP increased expression of GFP six-fold, but a stabilized promoter... example, the synthesis of deoxychromoviridans requires three genes whose proteins are needed sequentially... -
Tetracycline Inducible Expression
TypeCollection...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On ...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 PGK-H2BeGFP Chromatin H2B EGFP Mark Mercola 21217...21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens... -
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells
TypeBlog Post...hiPSCs EMX1 67% Mouse BM cells from GFP transgenic mouse GFP ~60-65% Human hepatocytes Myd88 ~...with CRISPR components. However, this sometimes requires intracellular injections into the cytoplasm or... -
Sequencing Primers
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP... -
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...drug resistance (Chen et al., 2013), fluorescence (GFP; Tzur et al., 2013), or rescue of mutant phenotypes...homology arms to knock in large epitopes, such as GFP (Paix et al., 2014). A further development of this...efficiencies, obtaining as many as 100 independent GFP knock-ins from a single injected animal. PAM sequence...sequence added, leaving a 34 bp “scar”, but currently requires additional experimental manipulation. In some ... -
Better Dyeing Through Chemistry & Small Molecule Fluorophores
TypeBlog Post...chemistry! The discovery of green fluorescent protein (GFP) sparked a renaissance in biological imaging. Suddenly...advances lead to an obvious question: In this age of GFP and its ilk, why should cell biologists talk to chemists...the frontiers of fluorescence microscopy often requires more photons. For example, moving from transient... -
Plasmids 101: Protein tags
TypeBlog Post...protease protection. Thus far Plasmids 101 has covered GFP and its related fluorescent proteins, which are sometimes... I Use? Plasmids 101: Green Fluorescent Protein (GFP) Fluorescent Protein Guide Expression Vectors from...cytometry, but rarely used for purification as elution requires low pH poly His HHHHHH 0.8 Affinity and Purification... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from ...promoter pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-copGFP-T2A-Puro 73032...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed... N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre 72256 Expresses copGFP and iCre under from the CB promoter...CB promoter pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance...tdTomato from the CB promoter pCDH-EF1-Fon-copGFP 72260 Expresses copGFP from the EF1 promoter when FLP is expressed... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...Mammalian U6 yes, cut S. pyogenes Kuehn pMCS-rybozyme-IRES-CAS9 64668 Mammalian yes, cut S. pyogenes W Fujii...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP... -
Antibodies 101: Affinity Tags
TypeBlog Post... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...must be performed after primary purification and requires a second clean up step to remove the cleaved tag...Also, purifying GST by affinity chromatography requires proper folding of the tag, which prevents insoluble.... Mammalian purification is still possible but requires optimization and often more stringent washing.... -
Penn Vector Core Partnership with Addgene
TypeCollection... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT... -
New Viral Vectors - March 2024
TypeBlog Post...Biosensor Looger New serotype pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST AAV9 Optogenetics Adesnik New viral vector...vector pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype pAAV-CaMKIIa-EGFP AAV PHP.eB...Chemogenetics Deisseroth New viral vector pAAV.CMV.PI.EGFP.WPRE.bGH AAV PHP.eB Controls Wilson New viral ...