Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 154 results for: N-pac

Showing: 41 - 60 of 154 results

  1. Hot Plasmids - September 2019 - CRISPR, Auxin Inducible Degradation, MerMAID Channelrhodopsins, and Genome Looping

    Type
    Blog Post
    ...deposit please sign up here.        New toolkit for N or C terminal tagging of proteins for degradation ...lab has created a new toolkit of plasmids for the N- or C- terminal tagging of proteins with mAID and ...can be limited by the need for a specific PAM (protospacer adjacent motif) in order to bind the target sites...These loops not only provide a 3-D structure for packing genomic DNA into nuclei, but are also thought to...

  2. Components of CRISPR/Cas9

    Type
    Blog Post
    ...and its variants have two endonuclease domains: the n-terminal RuvC-like nuclease domain and the HNH-like...Staphylococcus aureus (SA); SaCas9 3' NNGRRT or NNGRR(N)  Acidaminococcus sp. (AsCpf1) and Lachnospiraceae...RNA provided that target is upstream (5') of a protospacer adjacent motif (PAM) Cas9 endonuclease binding... RNA and a 3-base pair sequence known as the Protospacer Adjacent Motif or PAM. In order for dsDNA to ... and the unique stretches of DNA between them “spacers” (see figure below). After years of research, we... each direct repeat, combined with its adjacent spacer, ultimately encodes a single crRNA. The direct ...pre-crRNA into mature crRNA and tracrRNA binding. The spacer regions, on the other hand, are the unique, foreign...

  3. CASTing Off for New Shores in Human Genome Editing

    Type
    Blog Post
    ...Eitzinger, S., Miller, S. M., Berríos, K. N., McElroy, A. N., King, R. T., Stringham, O. G., Gelsinger...power of CRISPR combined with the large sequence capacity of transposons open whole new worlds to explore...

  4. SARS-CoV-2/COVID-19 Detection Methods Based on CRISPR/Cas

    Type
    Blog Post
    ...2020.02.29.971127 Rauch, J. N., Valois, E., Solley, S. C., Braig, F., Lach, R. S., Baxter, N. J., Kosik, K. S.,...., Phutela, R., Ansari, A. H., Sinha, D., Sharma, N., Kumar, M., … Maiti, S. (2020). Rapid, field-deployable...the target site, while Cas12a requires a PAM (Protospacer Adjacent Motif) for target cleavage. This test...

  5. CRISPR References and Information

    Type
    Collection
    ...expression: pAC2 , pAC152 , pAC153 , pAC154 ; pmax dCas9 activator expression: pAC91 , pAC92 , pAC93 , pAC94... Fly: gRNA cloning pAc-sgRNA-Cas9 PDF, 169 KB Marraffini Bacteria: pCas9 new spacer cloning pCas9 PDF,...pAC94 , pAC95 ; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination...pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis Cas9, or Cas12a from your input sequence...and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs. Currently supports: mouse...2014) (Link opens in a new window) . protoSpaceJAM protoSpaceJAM is an all-around platform for CRISPR ...destination: pAC90 PDF, 1.1 MB Katic Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone (pDR274...

  6. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...-07259-6 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L.,...s41587-021-01039-7 Pandey, S., Gao, X. D., Krasnow, N. A., McElroy, A., Tao, Y. A., Duby, J. E., Steinbeck...Zhou, W., Jiang, K., Garushyants, S. K., Roberts, N., Zhang, L., Vakulskas, C. A., Walker, J. A., Kadina... formation slightly. Designing the sgRNA with a spacer that only binds the edited strand, as in the PE3b...Phage-assisted evolution and protein engineering yield compact, efficient prime editors. Cell, 186(18), 3983-4002...

  7. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ...Cas9 recognizes the PAM sequence 5’-NGG-3’, where N can be any base. In Figure 5, we can see why: two ...-specific hydrogen bonds to the guanines, but the N (a thymine in this case) is only bound by the phosphate...References Bravo, J. P. K., Liu, M.-S., Hibshman, G. N., Dangerfield, T. L., Jung, K., McCool, R. S., Johnson...Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & Nureki, O. (2014). Crystal...important to choose a target sequence with a nearby protospacer-adjacent motif (PAM)? Cas9 is becoming an ever...

  8. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre... following protocol detailing the process for packaging these transfer vectors and generating new viral... WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene...

  9. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ..., Ran FA, Hsu PD, Konermann S, Shehata SI, Dohmae N, Ishitani R, Zhang F, Nureki O. Cell. 2014 Feb 27;..., Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature...gain-of-function screening when combined with a compact pooled sgRNA library. Our SAM-mediated screens ...

  10. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ..., Johansen, N. J., Hooper, M., Omstead, V., Vargas, S., Lerma, M. N., Taskin, N., Weed, N., Laird, W. ...Radaelli, C., Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O... Kalmbach, B., Lenz, G. H., Morin, E., Nguyen, T. N., Garren, E., Bendrick, J. L., Kim, T. K., Zhou, T...Armamentarium Collection Caltech Systemic Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer...

  11. Hot Plasmids and Viral Preps - January 2021

    Type
    Blog Post
    ... light, Vvd dimerizes bringing the C-terminal and N-terminal Cre fragments together and permitting recombinase...reduced RNA-off target footprint compared to current N-terminal linked SaCas9 ABE variants. It's also one.... https://pubmed.ncbi.nlm.nih.gov/24390935/ Hypercompact genome editor CRISPR-Casɸ By Melina Fan The ...toolbox with their discovery of CRISPR-Casɸ, a hypercompact genome editor from the Biggiephage clade of ...the Doudna Lab. Scientists looking for more compact genome editors due to delivery constraints and ...

  12. Making CRISPR Plasmids Using Fragmid

    Type
    Blog Post
    ... promoters, N’ and/or C’ terminus, and selection markers. Need fewer components? A spacer can be inserted...L., Szegletes, Z. M., Wen, B., Kraus, C., Miller, N. W., Steger, R. J., Escude Velasco, B., Bosch, J. ...entirely, but instead will have to replace it with a spacer.) Each component available on the Fragmid website...

  13. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ...resources   References Allikalt, A., Purkayastha, N., Flad, K., Schmidt, M. F., Tabor, A., Gmeiner, P....Patel, R., Lu, R., Macklin, J. J., Keller, P. J., Ji, N., & Lavis, L. D. (2017). A general method to fine-...Hayashi-Takanaka, Y., Stasevich, T. J., Kurumizaka, H., Nozaki, N., & Kimura, H. (2014). Evaluation of chemical fluorescent...realizing it. Yet, this selection is crucial as it will impact downstream outcomes of an experiment, including...Grimm & Lavis, 2022). These variations directly impact the way you can utilize these dyes. The most-used...emission of labeled agonists and antagonists, impacting the interpretation of experimental results. It's...dopamine D2/D3 receptors (Allikalt et al., 2020). Impact of labeling process: The process of dye labeling...

  14. Validated gRNA Sequences

    Type
    Collection
    ...26918244 Lu PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana...47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis...meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762...24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis 24076762 Church Protospacer...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...CCTCTTTGTCATCACGCTTC cut S. pyogenes 26789497 Corn AOC N. attenuata CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191...TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S....

  15. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ... J, Larghero J, Kabbara N, Dalle B, Gourmel B, Socie G, Chrétien S, Cartier N, Aubourg P, Fischer A, Cornetta...of three plasmids: the packaging, envelope, and transfer plasmids. The packaging plasmid carried a mutated...Advantages of lentivirus include a large genetic capacity and the ability to transduce both dividing and...mutated HIV-1 provirus that couldn’t package itself due to a few missing proteins. The envelope plasmid ...terminal repeats (LTRs) that facilitate viral packaging and host genome integration. After co-transfection...the brain (Figure 1). 2nd generation lentiviral packaging system The graphic below shows how the lentiviral... infect CD4+ cells. 3rd generation lentiviral packaging system Although the 2nd generation system is safer...

  16. The AAVantages of AAV in CRISPR Screens

    Type
    Blog Post
    ...Muller, A., Sousa, A. A., Tsai, S. Q., Bengtsson, N. E., Lööv, C., Ingelsson, M., Chamberlain, J. S., ...j.ymthe.2022.09.015 Ramani, B., Rose, I. V., Teyssier, N., Pan, A., Danner-Bocks, S., Sanghal, T., Yadanar,...to using AAV is the limited packaging capacity. Lentiviruses have capacities of 8–12 kb, while AAV only...libraries available at Addgene. The large packaging capacity and stable expression of lentiviral vectors...Lentivirus has limited packaging options, with most lentiviral vectors being packaged using VSV-G. In contrast...contrast, AAV can be packaged in a variety of capsids. To date, at least 12 different capsids, or serotypes...that when using Cas9, you’re already almost out of space! Don’t let this get you down for too long, though...

  17. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...annurev-biophys-083012-130404 Zhang N, Zhang D, Chen SL, Gong B-Q, Guo Y, Xu L, Zhang X-N, Li J-F (2018) Engineering...tpc.112.098509 Smits AH, Ziebell F, Joberty G, Zinn N, Mueller WF, Clauder-Münster S, Eberhard D, Fälth ...the most prevalent method due to ease of use and capacity to generate a long-term RNAi phenotype. Long hairpin...

  18. Common Injection Routes in Mice

    Type
    Blog Post
    ...liquid. Restraint: anesthesia Location: nose Gauge: n/a Volume: < 0.05 ml Skill required: beginner Oral ...) < 0.07 mL Advanced Intranasal Anesthesia Nose n/a < 0.05 mL Beginner Oral gavage Scruffing Throat...injections are given in the peritoneal cavity, or the space surrounding organs in the abdomen. They are a popular...cerebral spinal fluid. The injection site is the space in and around the vertebrae, so hitting the correct...

  19. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    ...PubMed PMID: 4355596 King, S. R., Duggal, N. K., Ndongmo, C. B., Pacut, C., & Telesnitsky, A. (2008). Pseudodiploid...Teich, N. (1971). Noninfectious ARK mouse embryo cell lines in which each cell has the capacity to be ...the genetic code for reverse transcriptase are packaged (Wu et al., 1997) inside of the capsid . This ...the vector particle, some of the RT protein gets packaged inside of the vector particle, along with its ...-type viral genome can direct the production, packaging, and release of progeny viral particles. And there... Temin, H. M. (1990). Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudodiploidy...

  20. Plasmids 101: Secondary Nanobody Toolbox

    Type
    Blog Post
    ...Antibody Subclass Nanobody Addgene Plasmid Rabbit N/A* TP897 pTP1183 (1x cysteine) pTP955 (3x cysteines.... Nanobodies will bind to the column due to their N-terminal His14-bdNEDD8 tag. After several washes, ...antibody (HCab), which are unique to camels, llamas, alpacas and other camelids. In terms of structure, HCabs...have done the hard work for you by immunizing an alpaca, isolating HCab antibodies from its serum, and ...for generating nanobodies are outlined below; no alpaca required. Decide Which Nanobody To Use: The table...
Showing: 41 - 60 of 154 results