We narrowed to 30 results for: N-pac
-
TypeCollection...sequence in the 3' UTR Carl Novina 33154 pAC-Luc Firefly Creation of N-terminal Firefly fusions in Drosopholia...Optical reporter of presynaptic ATP Timothy Ryan 24348 pAC-hRluc Renilla Actin5C Insect expression of Renilla... 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko...87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning. Lentiviral... 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko... John Atkins 174050 pGWB-nLUC Firefly Creation of N-terminal Firefly luciferase fragment for split-luciferase...NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian U6 yes, cut N. meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1 64116 Mammalian/Lentiviral U6 none N. meningitidis...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1 64118 Mammalian/Lentiviral U6 none N. meningitidis...cut N. meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708...BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330 Drosophila BspQI yes, cut S. pyogenes... to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds are specific for...pyogenes Huang PX853 62885 Mammalian BbsI yes, cut, N-terminal S. pyogenes Zhang PX854 62886 Mammalian BbsI... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...that adds an N-terminal myristoylation signal GST Protein purification pEBG - N-terminal GST... N-terminal His6-GST-TEV for bacterial expression pDest-565 - N-terminal ...tag pNIC-GST-TEV-GG - Cloning of target gene with N-terminal GST tag and TEV cleavage Transient expression... for C-terminal tags and omit the start codon for N-terminal tags. And when you are designing your plasmid...c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA for mammalian expression pNIC-CTHF...PCR-based C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG tag in pCS for...tag pcDNA3.1-HA - Mammalian expression vector with N-terminal HA tag pInducer20 - Tet-inducible HA-tagged... -
CRISPR Pooled gRNA Libraries
TypeCollection...Cas13a/C2c2 Protospacer flanking site (PFS) Library 79153 Knockout E. coli Zhang N/A N/A N/A - The protospacers...3rd N/A N/A Retroviral Mouse Genome-wide CRISPR Knockout Library 104861 Knockout Mouse Teichmann N/A (...Mitochondrial DNA (CARM) Library 82480 Knockout Mouse Xie N/A N/A 395 CRISPRa Discontinued Activation Human Weissman...Knockout T. gondii Lourido N/A 10 8,158 TUNEYALI Library 217744 Knockout Yeast Borodina N/A 1 56 Turner Lab Human...Inhibition Library v1 115927 Inhibition E. coli Bikard N/A 19 92,919 Bikard Lab EcoWG1: E. coli Genome-wide...Inhibition Library v2 131625 Inhibition E. coli Bikard N/A ∼5 21,417 Bison sgRNA Library 169942 Knockout Human...Transporter Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927... -
CRISPR Guide
TypeCollection... Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan, ...34478496 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L.,...Ter-Ovanesyan, D., Braff, J. L., Davidsohn, N., Housden, B. E., Perrimon, N., Weiss, R., Aach, J., Collins, J. ...Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A....Dy, A. J., Joung, J., Verdine, V., Donghia, N., Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya...Yachie, N., . . . Nureki, O. (2018). Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science...1964. PMID: 29891532 Gaudelli, N. M., Komor, A. C., Rees, H. A., Packer, M. S., Badran, A. H., Bryson,... -
TALEN Plasmids and Kits
TypeCollection... tag and an SV40 NLS at the N terminus, a 152-residue deletion from the N terminus of the wild-type TALE... The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation at rates much ...into a pCS2 expression vector resulting in shorter N- and C-terminal tal protein segments (136AA and 63AA...the T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which.../mRNA synthesis vectors containing unique shorter N- and C-terminal domains (N153AA, C47AA). The reporter...Construction and Evaluation Accessory Pack Takashi Yamamoto This accessory pack contains modified pFUS array vectors... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...Stachelhaus et al. (1998) References George N, Pick H, Vogel H, Johnsson N, Johnsson K. 2004. Specific labeling...PMID:9712910 Vivero-Pol L, George N, Krumm H, Johnsson K, Johnsson N. 2005. Multicolor imaging of cell... 101131 pACP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization 101128 pACP-ADRβ2 Control...backbone for transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag Empty backbone for... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...mCherry Ari Helenius 37533 cfSGFP2-N Extracellular milieu cfSGFP2-N EGFP Ikuo Wada 73208 pcDNA3.1-COXIV-COX8...Davidson 98822 Lck-mTurquoise2 Plasma Membrane Lck N-terminal lipidation signal mTurquoise2 Dorus Gadella...Gadella 98821 Lck-mScarlet-I Plasma Membrane Lck N-terminal lipidation signal mScarlet-I Dorus Gadella 50057...Membrane Mff acGFP1 Gia Voeltz 158007 pCMV-mGold-Mito-N-7 Mitochondria Cox8A mGold Francois St-Pierre 49151...Peroxisome SRL mScarlet Dorus Gadella 55146 mCherry-TOMM20-N-10 Mitochondria-Outer Membrane TOMM20 mCherry* Michael...CCDC11 EGFP Ken-Ichi Takemaru 54234 mEmerald-PLK1-N-16 Centrosome Plk1 mEmerald* Michael Davidson 54491.../ GJA1 sfGFP David Spray 54959 mApple-VE-Cadherin-N-10 Tight Junctions VE-Cadherin mApple Michael Davidson... -
CRISPR References and Information
TypeCollection...expression: pAC2 , pAC152 , pAC153 , pAC154 ; pmax dCas9 activator expression: pAC91 , pAC92 , pAC93 , pAC94... Fly: gRNA cloning pAc-sgRNA-Cas9 PDF, 169 KB Marraffini Bacteria: pCas9 new spacer cloning pCas9 PDF,...pAC94 , pAC95 ; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination...pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis Cas9, or Cas12a from your input sequence...and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs. Currently supports: mouse...2014) (Link opens in a new window) . protoSpaceJAM protoSpaceJAM is an all-around platform for CRISPR ...destination: pAC90 PDF, 1.1 MB Katic Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone (pDR274... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre... following protocol detailing the process for packaging these transfer vectors and generating new viral... WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection..., Johansen, N. J., Hooper, M., Omstead, V., Vargas, S., Lerma, M. N., Taskin, N., Weed, N., Laird, W. ...Radaelli, C., Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O... Kalmbach, B., Lenz, G. H., Morin, E., Nguyen, T. N., Garren, E., Bendrick, J. L., Kim, T. K., Zhou, T...Armamentarium Collection Caltech Systemic Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer... -
Validated gRNA Sequences
TypeCollection...26918244 Lu PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana...47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis...meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762...24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis 24076762 Church Protospacer...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...CCTCTTTGTCATCACGCTTC cut S. pyogenes 26789497 Corn AOC N. attenuata CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191...TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S.... -
COVID-19 Resources
TypeCollection...Schroeder, S., Krüger, N., Herrler, T., Erichsen, S., Schiergens, T. S., Herrler, G., Wu, N. H., Nitsche, A.... small envelope protein, E; nucleocapsid protein, N; and membrane protein, M), including plasmids for ...Liu, Y.Y., Wang, Q.Y., Bian, H., Zhu, P., Chen, Z. N. (2020). CD147-spike protein is a novel route for ...neutralization assays and links to popular envelope and packaging plasmids. Ginkgo Bioworks Plasmid Collection –... -
Mammalian RNAi Tools
TypeCollection...Karimloo, R., Rezaiean, O., Moradzadeh, A., Mehmandoost, N., Moazzen, F., Mazraeh, A., Marmari, V., Ebrahimi,...new window) . Rao, D. D., Vorhies, J. S., Senzer, N., & Nemunaitis, J. (2009). siRNA vs. shRNA: Similarities...protocol Other Addgene viral protocols Lentiviral packaging plasmids Web Resources Trono Lab Lentivectors ... -
CRISPR History and Development for Genome Engineering
TypeCollection...28931002 Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. 2013...Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman... 339(6121):823-6. PMID: 23287722 Pawluk A, Amrani N, Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, Edraki... P, Fedorova I, Kneppers J, DeGennaro EM, Winblad N, Choudhury SR, Abudayyeh OO, Gootenberg JS, Wu WY,...contains many unique protospacer sequences that have homology to foreign DNA. Protospacers are separated by...Adaptive Immune System CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequences were initially...contain a species-specific sequence known as a protospacer adjacent motif (PAM). The CRISPR complex binds... -
mTOR Pathway
TypeCollection...machinery in cancer. Bhat M, Robichaud N, Hulea L, Sonenberg N, Pelletier J, Topisirovic I. Nat Rev Drug... survival and cytoskeletal organization. Cancer Impact Enhanced signaling through either mTORC1 or mTORC2... -
Zhang Lab CRISPR Page
TypeCollection.... Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science..., Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature...-Cas9. Swiech L, Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol...Heidenreich M, Xavier RJ, Langer 9, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct...- Cas9 Mouse CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a microbial ...SaCas9) that has been human codon-optimized, and packages both the SaCas9 gene and its single guide RNA ... -
Neurodegeneration Plasmid Collection
TypeCollection...mTFP1-MAPTau-N-10 MAPT mTFP1 CMV Parkinson's, FTD Michael Davidson 55570 mTurquoise-MAPTau-N-10 MAPT mTurquoise... mPlum-MAPTau-N-10 MAPT mPlum CMV Parkinson's, FTD Michael Davidson 56230 mIFP-MAPTau-N-10 MAPT mIFP CMV...mPA-GFP-MAPTau-N-10 MAPT GFP CMV Parkinson's, FTD Michael Davidson 57286 Dronpa-MAPTau-N-10 MAPT Dronpa....2-MAPTau-N-10 MAPT mEos3.2 CMV Parkinson's, FTD Michael Davidson 57552 mGeos2-VEL-MAPTau-N-10 MAPT mGeos2...leukoencephalopathy Dong-Er Zhang 13313 pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT...Parkinson's Mark Cookson 13315 pcDNA-DEST53 PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47...Parkinson's Michael J Fox Foundation MJFF 40403 pBACgus N-His/GST/LRRK2 1867-2186 LRRK2 His, TEV, GST polH Parkinson's... -
Plan Your Experiment
TypeCollection...Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., Burks, T., Raychowdhury, R., Adamson... T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq: Dissecting Molecular...Zukher, I., Dujardin, G., Sousa-Luís, R., & Proudfoot, N. J. (2023). Elongation roadblocks mediated by dCas9...vectors is that the packaging limit (how large of a DNA sequence you can actually package into your viral ...Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system...efficiencies. The template sequences can also have a large impact on editing efficiency. So while testing multiple...promoters, and selection markers. There are also no packaging limits as there are for viral vectors — the only... -
Recombinases AAV Preps
TypeCollection... Esteban Engel , Alexander Nectow 69570 pAAV-EF1a-N-CretrcintG EF1a none 1 Connie Cepko 69571 pAAV-EF1a-C-CreintG... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...