Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 43 results for: NAK

Showing: 41 - 43 of 43 results

  1. Chemogenetics Guide

    Type
    Guide
    ...Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq hM1Dq hM5Dq Human M3 muscarinic...Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada M, Higuchi M, Jin J, Roth ...1167. PMID: 32632286 (Link opens in a new window) Nakajima K, Wess J (2012). Design and functional characterization...

  2. CRISPR Guide

    Type
    Guide
    ...Gootenberg, J. S., Mori, H., Oura, S., Holmes, B., Tanaka, M., Seki, M., Hirano, H., Aburatani, H., Ishitani...., Sonpho, E., Xu, H., Sasakawa, N., Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda,...

  3. Sequencing Primers

    Type
    Guide
    ...forward primer pMX-S1811 GACGGCATCGCAGCTTGGATACAC (Yamanaka lab) MMLV sequence, 5' of MCS in pMXs vector, ...
Showing: 41 - 43 of 43 results