Addgene

We narrowed to 106 results for: Ubc

Showing: 41 - 60 of 106 results

Results per page:

Plasmids 101: Origin of Replication

Type

Blog Post

...results always pick a single colony and do not subculture directly from glycerol stocks, agar stabs, or...
Addgene Begins Distribution of Recombinant Antibodies

Type

Blog Post

...Engebrecht J, Trimmer JS (2019) A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...
HA Frankenbody, a New Imaging Tool to Visualize Single Molecules and Nascent Peptides

Type

Blog Post

... fluorescent protein guide Find plasmids for subcellular localization Find fluorescent protein plasmids...
Predicting Adverse Reactions to Monoclonal Antibody Drugs

Type

Blog Post

... lymphatic system or even the human skin and subcutaneous models (Groell et.al, 2018). Treating these ...
Hot Plasmids - January 2023

Type

Blog Post

... here! Andrews NP, et. al. A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...
Fluorescent Proteins 101: Luciferase

Type

Blog Post

.../Phototoxicity Not susceptible Susceptible Subcellular Imaging Improving Well-established High-throughput...
Sequencing Primers

Type

Guide

...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...
Hot Plasmids December 2018 - C. elegans RNAi, TurboID, Detecting Viral Outbreaks, and Protein Binding Specificity Tools

Type

Blog Post

...to studying membranes, organelles, and other subcellular compartments is via proteomics--the study of ...
A Practical Approach to Choosing the B(right)est Fluorescent Protein

Type

Blog Post

...Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse the entire Fluorescent Protein...
Luminescent Imaging with Nano-lanterns

Type

Blog Post

...phototoxicity, they successfully imaged multiple subcellular compartments over several minutes using Nano-...
Behind the scenes: Addgene’s new search engine and more

Type

Blog Post

...educational resources, and depositors — each with subcategories such as plasmids and viral preps for catalog...
Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

Type

Blog Post

...photo-reversible protein-protein interactions can control subcellular localization processes in vivo. They deposited...
Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

Type

Blog Post

...Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse the entire Fluorescent Protein...
Choosing the B(right)est Fluorescent Protein: Photostability

Type

Blog Post

...Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse the entire Fluorescent Protein...
Tagging Optogenetics and Chemogenetics Receptors: Fluorescent Proteins and Other Options

Type

Blog Post

...the same cell, but not necessarily at the same subcellular compartment as the opsin or chemogenetic receptor...
Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools

Type

Blog Post

...distribution of clusters without accumulation in subcellular compartments such as nuclear speckles. Furthermore...
Hot Plasmids - October 2020

Type

Blog Post

...-wrmScarlet labeling proteins with different subcellular locations. Image from Goudeau et al., 2020. ...
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

Type

Blog Post

...recombinase. Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and...
Plasmid-based Recombinant Monoclonal Antibodies: What They Are and Why You Should Be Excited About Them

Type

Blog Post

...Engebrecht J, Trimmer JS (2019) A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...
Viral Vectors 101: Chemogenetics

Type

Blog Post

... where specific tissues, cell types, or even subcellular regions of a neuron need to be targeted. Targeting...

Showing: 41 - 60 of 106 results

Results per page:

Plasmids 101: Origin of Replication

Addgene Begins Distribution of Recombinant Antibodies

HA Frankenbody, a New Imaging Tool to Visualize Single Molecules and Nascent Peptides

Predicting Adverse Reactions to Monoclonal Antibody Drugs

Hot Plasmids - January 2023

Fluorescent Proteins 101: Luciferase

Sequencing Primers

Hot Plasmids December 2018 - C. elegans RNAi, TurboID, Detecting Viral Outbreaks, and Protein Binding Specificity Tools

A Practical Approach to Choosing the B(right)est Fluorescent Protein

Luminescent Imaging with Nano-lanterns

Behind the scenes: Addgene’s new search engine and more

Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

Choosing the B(right)est Fluorescent Protein: Photostability

Tagging Optogenetics and Chemogenetics Receptors: Fluorescent Proteins and Other Options

Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools

Hot Plasmids - October 2020

Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

Plasmid-based Recombinant Monoclonal Antibodies: What They Are and Why You Should Be Excited About Them

Viral Vectors 101: Chemogenetics

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections