We narrowed to 5 results for: Ubc

...Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F...

...antibodies can be isotype-specific or even isotype subclass-specific. This specificity can be used to ensure...Isotype Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears...should never be stored below 4 °C. Certain isotype subclasses, such as IgG3, aggregate after thawing and therefore...different species of origin, isotypes, and isotype subclasses of a primary antibody, which becomes the limiting...? You may need to buy isotype-specific or even subclass-specific secondary antibodies to allow for differentiation...

...multiple cloning site (MCS). You can easily move (subclone) any piece of DNA that already has restriction...

...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression...

...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...