Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 333 results for: cki

Showing: 41 - 60 of 333 results

  1. Improved Plasmid Maps Powered by SnapGene

    Type
    Blog Post
    ...cutters. You can also sort enzymes by clicking on column heads. Clicking on a particular restriction enzyme...GSL Biotech's SnapGene Server Software. With the backing of SnapGene’s sequence viewer software and extensive...Maps This is the first tab you’ll land on after clicking the “Analyze Sequence” button. The maps hosted...similar hover over features. As with the map tab, clicking on two separate locations in the linear sequence...Types listed are standard GenBank feature types. Clicking on a particular feature here also highlights that...binding site locations, lengths, and direction. Clicking on a particular primer here also highlights it...updates in the comments section below and keep checking in at blog.addgene.org for additional enhancements...

  2. Design Tips for Prime Editing

    Type
    Blog Post
    ...tool of choice. Nicking sgRNAs PE3 and PE5: These tools use an sgRNA to guide nicking of the unedited...editors bound to sgRNAs only drive nicking (right). Start with nicking sgRNAs ~50 bp from the prime editing... Figure 7: Nicking sgRNAs can be designed to target edited DNA, so that nicking only occurs after... prevents the Cas9 nickase from re-binding and nicking the newly synthesized strand before heteroduplex...BioRender.com. PE3b and PE5b: In this approach, the nicking sgRNA is designed to bind only after the edit is...

  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...non-integrating episomes to allow sorting and dosage tracking of reprogramming factors Fluorescent tagged episomals...

  4. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...making the detection of rare events difficult. Dickinson et al. sought to create a new and efficient selection-based...Figure 1: Self-excising cassette schematic from Dickinson et al. (2015). Used with permission from the Genetics...for the targeted gene. After initial testing, Dickinson et al. tested this system across 7 genes in parallel...modification. Figure 2: Schematic from Dickinson et al. (2015) illustrating the steps to fluorescently...Society of America. Applications of this system Dickinson et al. have developed a modular system that requires...with a Self-Excising Drug Selection Cassette. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein...using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods...

  5. Tips from the Repository Trenches: Using Barcodes to Track Samples

    Type
    Blog Post
    ...scanned to verify that it is the correct sample. Tracking samples - it's all about location, location, location...it could take us hours just to find one sample! Luckily, if a rack of tubes is dropped at any point in ...in house if necessary.   Tips for barcoding and tracking samples 1. Start with the tube - Barcoded tubes... information in a small space and is ideal for tracking large collections. Many companies, such as Thermo...Although we’ve developed our own computer system for tracking samples, it can be done easily with a barcode ...multiple people or even multiple labs. Careful tracking prevents us Addgenies from wasting hours of valuable... sample tracking...

  6. Antibodies 101: The Basics of Western Blotting

    Type
    Blog Post
    ...improve resolution, use a stacking gel on top of the resolving gel. A stacking gel typically has a different...buffer, blocking the membrane  from binding to the antibodies during the stain. The ideal blocking buffer...of the proteins in a sample migrate through the stacking gel at the same pace and enter the resolving gel...include suggestions for working concentrations, blocking buffers, and incubation times. If the vendor includes...

  7. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...available for tracking certain cell types. Another useful tool for marking and tracking cells is the the... Pathogens - Kamenyeva et al, 2015. Cellular trafficking studies enabled by fluorescent proteins The optimization...that some are more reliable and more efficient at tracking cells. Good two-photon probes when using a standard...photoactivable or photoconvertible proteins, as it enables tracking throughout the lifetime of the cell.     The past... cellular trafficking...

  8. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...monitoring the first round of translation or by tracking the translation of a single mRNA over time. Both...translation. Single molecule continuous translation tracking TRICK allows you to see the first round of translation...translation, but it doesn’t allow continued tracking of a given mRNA because NLS-PCP-GFP is removed by ...first ribosome that translates the mRNA. To permit tracking over time, Yan et al. devised a system that labels...keeps it in a single field of view for constant tracking. You can then directly monitor multiple rounds...

  9. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ... account, you can begin the deposit process by clicking "Submit Online Deposit" (for online submission... menu: Figure 1: Begin the deposit process by clicking "Submit Online Deposit" or "Download Deposit Spreadsheet...  Figure 4: Add plasmids to the article by clicking “Add Plasmid to this Article” (left) and entering...button and jump around to the different pages by clicking on the appropriate boxes at the top of the page...the plasmid to copy from the drop-down menu and clicking the white "Copy" button. *Note: The "Copy" button...Submit Deposit" button to complete the data entry. Clicking the "Submit Deposit" button will allow you to ...

  10. Rosella: A Fluorescent pH-Biosensor for Studying Autophagy

    Type
    Blog Post
    ... have fused with the vacuole or a lysosome are trickier to identify because their contents can be at various...autophagosomal membranes, so tagging it with GFP allows for tracking the localization or accumulation of pre-autophagosomal...an autophagy-independent manner. Additionally, tracking Atg8p or LC3 doesn’t provide information about...easier to study the mechanisms behind autophagy by tracking what’s being transported to the yeast vacuole ...vacuole (i.e. cytosol, mitochondria), rather than tracking generic autophagy markers. It’s particularly useful...

  12. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ...fluorescent proteins to oligomerize is known as “stickiness.” Since the fluorescent tag should operate as... per unit.  There are several ways to measure stickiness. In vitro, ultracentrifugation or gel filtration...oligomerization in cells. In addition to measuring stickiness, several researchers have also collected data...characteristics are important, but have less priority than stickiness. In my experience, fluorescent proteins that ...independent of GDI-mediated extraction and actin-based trafficking." PLoS biology 13.4 (2015): e1002097. PubMed ...

  13. Adeno-associated Viruses (AAVs) for Genome Editing

    Type
    Blog Post
    ... CRISPR-based approaches for the generation of knockins via homologous recombination with a homologous...application - the creation of sequence-specific knockins - for which the AAV approach is most well suited...suited, since it routinely generates knockin efficiencies of 1-40% with G418-selected clones. However, there... CRISPR-based approaches for the generation of knockins, it is not always ideal. Because of these limitations...essentially all of an AAV’s ~4.5 kB packaging capacity. Luckily, researchers have devised methods to deliver CRISPR...

  14. Deep Mutational Scanning with One Pot Saturation Mutagenesis

    Type
    Blog Post
    ...authors’ compared nicking the top strand first followed by the bottom strand versus nicking the bottom strand...with a twist since it relies on the sequential nicking, degradation, and PCR-generation of a mutant version...Supplementary Note 1 in Wrenbeck et al for details on how nicking was optimized. How should I design my mutagenic...gene of interest has a BbvCI site(s). If so, the nicking mutagenesis protocol will still work if the orientation...

  15. Validated gRNA Sequences

    Type
    Collection
    ...interfere S. pyogenes 26689101 Hudson xylR C. beijerinckii CGAGTTAGACATAATAGTGA 73228 nick S. pyogenes ...

  16. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...edit and homology to the genomic DNA locus. After nicking by Cas9, the homologous pegRNA sequence hybridizes...previously used when they developed base editing. By nicking the non-edited strand, they can cause the cell ...efficiencies 2-3-fold. However, the process of double nicking increases indel formation slightly. Designing the...the edited strand, as in the PE3b system, guides nicking of the unedited strand only after editing has occurred... ✓ ✓ ✓   ✓ Second sgRNA to guide nicking of the unedited strand Favor the edited strand...

  19. R Bodies: Membrane-Rupturing Microscopic Tools

    Type
    Blog Post
    ...biological motion (whether endocytosis, vesicle trafficking, or muscle contractions) are produced by orchestrated...were first expressed in E. coli in the 1980s  (Kanabrocki et al 1986). Much later, it was shown that putting...her on Twitter @jessicapolka.     References 1. Kanabrocki, J. A., Quackenbush, R. L. & Pond, F. R. Organization...

  20. Viral Vectors 101: Chemogenetics

    Type
    Blog Post
    ...ever-growing variety of recombinase systems. Picking Ligands Picking the right ligand is also important for ...blood-brain barrier.  Another consideration when picking ligands for chemogenetic studies is whether or ... are viable for translation to human patients. Picking receptors The receptor you choose is largely dependent...
Showing: 41 - 60 of 333 results