Skip to main content

We narrowed to 58 results for: human c myc

Showing: 41 - 58 of 58 results
  1. CRISPR References and Information

    Type
    Collection
    ... cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish, mouse, rat, and human. Developed by the Stanley...Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (pSIR-hCD2...location, and genome annotation. Available genomes are human (hg19 & hg38), mouse (mm10), and yeast (strain w303... a set of similar sequences. Organisms include human, mouse, rat, chicken, frog, zebrafish, fly, worm...on-target activity for selected target(s). Uses human, mouse, and rat reference genomes. Hosted by the...meningitidis Cas9 PAMs. Currently supports: mouse and human. Developed by the George Church Lab . CRISPR Optimal...GABPA, and RAD21 PDF, 138 KB Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector...
  2. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ...There are over 40 trillion cells that make up the human body and G-baToN provides versibility in tracking...interactions New auxin inducible degron system for C. elegans New CRISPR plasmids New items from the viral...tool-kit for the auxin inducible degron (AID) system in C. elegans By Alyssa Cecchetelli The auxin inducible... degron (AID) system has been extensively used in C. elegans since 2015 to conditionally degrade proteins...repression, and editing with a single Cas9-VPR in Saccharomyces cerevisiae. To control Cas9 activity and influence...
  3. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...my target sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary...nucleotide to the start of my target sequence? A3: The human U6 promoter prefers a 'G' at the transcription start...10.1126/science.1231143  Elliott, B., Richardson, C., Winderbaum, J., Nickoloff, J. A., & Jasin, M. (1998....1128/mcb.18.1.93  Ran, F. A., Hsu, P. D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E....j.cell.2011.06.019  Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch...j.cell.2013.04.025  Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L., & Jaenisch, R. (2013)....marker such as puromycin, you can (also) select for the positive colonies by puromycin selection. You ...
  4. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...(unless if you count normal human interaction for all of us studying human genes in test tubes and gels...Mello) These very cute birds learn their songs like humans learn speech. Finches must learn early, use auditory...existence, but most abundant cell on earth (twice the human biomass). The lab is developing a system using novel...habitats - even 50 meters from Old Faithful in 60 °C soils. Dendrobatidae (Lauren O’Connell)  Poison frogs...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...
  5. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular... neurons to form the functional networks of the human brain.     Acknowledgement:Through a partnership...identification of FLPe which has a temperature optimum of 37 °C (Buchholz, Angrand, and Stewart 1998). FLPe’s performance... receptor (ER) ligand binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These...Sadowski. 1985. “The FLP Recombinase of the Saccharomyces Cerevisiae 2 Micron Plasmid Attaches Covalently...
  6. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...based on: Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic...expression vector. All His-tags are cloned at the C-terminus of MDH and, if indicated on the plasmid map...
  7. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ...production of lentiviral and retroviral vectors.” Human Gene Therapy Clinical Development 25.3 (2014). 175... for less than a day, lentivirus can be kept at 4°C. For long-term storage, viral preps should be divided...divided into single-use aliquots, and stored at -80°C. Some reports suggest rapidly freezing virus in a ... labs and hinders experiments is mycoplasma contamination. Mycoplasma contamination has been shown to ...routinely test for mycoplasma contamination. There are several commercially available mycoplasma detection kits...larger microbes such as yeast, fungi, or bacteria, mycoplasma can be extremely hard to detect with levels reaching...cells per ml before the media becomes cloudy. Mycoplasma compete with host cells for nutrients and can...
  8. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward...Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' ...Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3'...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...
  9. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...optimized PE2 enzyme containing RT optimized for human codons, additional nuclear localization signals,...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
  10. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...be fused to a ligand-binding domain such as the human estrogen receptor (ERT2) so that the enzyme is only... a circular piece of DNA (and is not maintained). C) If the sites are on separate DNA molecules (in trans...proteins: The recombinase is split into inactive N- and C-terminal fragments and placed under the control of...integrase, derived from a Streptomyces phage, and Bxb1 integrase, from a mycobacteriophage, are serine SSRs that... inducible system (e.g., search for "split", "rapamycin", “tamoxifen”, or “light”): Cre Recombinase Plasmids...
  11. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ...target a specific locus to create a knock-out in human embryonic stem cells.  Find GEmCherry2 reporter ...these methods a try.  References Højland Knudsen C, Ásgrímsdóttir ES, Rahimi K, Gill KP, Frandsen S, ...stably integrate a reporter gene that contains a puromycin resistance gene followed by the target site (the...genome edit:  A donor plasmid that contains a puromycin resistance gene linked to an in-frame H2B-GFP....
  12. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...3,300-fold in Drosophila cells and ~24,000-fold in human HeLa cells as compared to basal expression. Co-expression...also shown that the Q system is also functional in C. elegans. Subsequent work by the Luo and Potter labs...23995928; PMCID: PMC3811519.Seo SO, Schmidt-Dannert C. Development of a synthetic cumate-inducible gene ...; PMCID: PMC5270762. Wendler, F., Park, S., Hill, C. et al. A LexAop > UAS > QUAS trimeric plasmid to ...genes for metabolic engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197...
  13. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison of different... easy for a researcher to quickly generate N- and C-terminal epitope tag fusions to a protein of interest...et al. "Adaptation of Enterococcus faecalis to daptomycin reveals an ordered progression to resistance....
  14. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ... Rinehart lab synthesized the activated form of human mitogen-activated ERK activating kinase 1 (MEK1)...the mitochondrial targeting sequence of cytochrome c oxidase subunit VIII, so that they can be imported...pCoofy series of plasmids contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP...N-terminal tag, coding sequence of the gene of interest, C-terminal tag, plant terminator, and plant resistance... The strategy relies on several observations: Rapamycin is a membrane-permeable pharmacological agent ...induction heterodimerization of proteins that contain rapamycin-binding domains, such as FKBP and FRB. The cell...membrane protein with a FRB domain (MitoTRAP). Rapamycin binds your recombinant protein (via FKBP) and ...
  15. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...thousand base pairs from the entire human genome. Digesting the human genome with restriction enzymes would...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...DNA molecules. To isolate a particular gene from human chromosomal DNA, it would be necessary to isolate...organisms, including plants, worms, mice, and cultured human cells. Have diverse applications — Although plasmids...strains of E. coli , some of which are deadly to humans. Most of all common, commercial lab strains of ...
  16. Visualizing Protein Turnover In Situ

    Type
    Blog Post
    ...ti2learning.org. References 1. Dieterich, Daniela C., et al. "In situ visualization and dynamics of newly...Nathans, Daniel. "Puromycin inhibition of protein synthesis: incorporation of puromycin into peptide chains...attended a very interesting talk by Prof. Erin M Schuman, a former Caltech researcher, now Director at the...newly synthesized proteins with FUNCAT Professor Schuman’s technique applies metabolic labeling using a noncanonical...the turnover of one specific protein. Professor Schuman’s lab showed that FUNCAT’s usefulness can be extended...interaction. To study protein levels in situ, the Schumann lab used a modified version of PLA where one antibody...Yarmolinsky, Michael B., and L. Gabriel. "Inhibition by puromycin of amino acid incorporation into protein." Proceedings...
  17. Lentiviral Vector Guide

    Type
    Guide
    ...Ehrnstroem, B., & Baum, C. (2013). Biosafety features of lentiviral vectors. Human Gene Therapy , 24 (2).... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...species. Some common types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency...process requires a production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard ... Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343 (6166), 84–87. https://doi....PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz, D., Bickmore, ...PMID: 18092005 Merten, O., Hebben, M., & Bovolenta, C. (2016). Production of lentiviral vectors. Molecular...
  18. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-retroviral vectors can be packaged directly in human embryonic kidney 293T (HEK293T) cells (Figure 3A.... M. (2003). Transcription start regions in the human genome are favored targets for MLV integration. ...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral vectors:...Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith, K., Price, J... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
Showing: 41 - 58 of 58 results