Skip to main content
Addgene

We narrowed to 363 results for: tac

Showing: 41 - 60 of 363 results
  1. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ...irreversibly with a small substrate ligand motif attached to a fluorophore (Figure 1b). Engineered ligases...phosphopantetheinyltransferase) – These enzymes catalyze the covalent attachment of a fluorophore ligand to a peptide tag (Figure...bioorthogonal chemical reactions (i.e., click chemistry) to attach a fluorophore at the specific site of incorporation... the speed and selectivity of the fluorophore attachment, the brightness of the resulting conjugate, and...for samples where washing is difficult, such as intact tissue. Some chemical labeling strategies such ...
  2. Plasmids 101: Biotinylation

    Type
    Blog Post
    ...cofactor that in its active form is covalently attached to the active site of key metabolic enzymes including...Southern/Northern blotting Cell surface labelling Attaching polypeptides to a substrate Flow cytometry/fluorescence-activated...Photobiotin acetate consists of a biotin molecule attached to a photoreactive arylazide group. Under strong...methods. Scientists have commonly used this method to attach proteins or polypeptides to a solid substrate (... & Cronan, J. E. “Molecular Biology of Biotin Attachment to Proteins; Symposium: Nutrition, Biochemistry...
  3. Building Global Connections with the International Mentorship Program USA-EUROPE

    Type
    Blog Post
    ...professional internationalization faces several obstacles; for instance there are few resources to help ...University of Valencia): “It is very inspiring to be in contact with mentors who are at a professional level where...professional collaborations, setting up bases and contacts with Spanish laboratories to start working on ...needed to pursue them, increased their network of contacts important for their career goals, and identified.... Two independent scientists, who did not have contact with the program, evaluated survey results. Participants...
  4. PEI Calculator for Planning AAV Packaging Transfections

    Type
    Blog Post
    ...transfection in: 15 cm dishes OR CF5 stacks Select how many dishes or stacks you plan to transfect: 1 to ...following μg of each plasmid needed per dish or stack. Calculations are based on using 28 μg of total ...) per 15 cm dish or 2500 μg of plasmids per CF5 stack. Total ug of each plasmid needed for the whole experiment...
  5. Sequencing Primers

    Type
    Guide
    ...terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG (Waugh lab) Tac promoter, forward primer...primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning ...-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer Full Primer ...5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence...sequence, forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1...
  6. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...bolster and modulate our immune defenses to better attack cancer. Combing our knowledge with our bodies’ ...created by the cancer cells to shield themselves from attack. It is a region of incessant chemical activity,...that suppress APCs. T cells that would normally attack the cancer cells are also suppressed by chemical...microenvironment TGFβ, IL-10, can also help the immune system attack tumors. Attempts have been made to use whole cell...collaborative therapies must be explored. When attacking cancer, multiple immunotherapy targets can be ...
  7. Addgene @ Keystone: Thoughts on Precision Genome Engineering and Synbio

    Type
    Blog Post
    ...fishing, and local grizzly bear attacks. He described one such recent attack as "hilarious". Welcome to Montana...and I have an internal motto for scientists who contact us and want a guarantee that their experiments ...really, really hard. That so many scientists are tackling this type of genetic engineering is a testament...
  8. Management for Scientists: What Makes a Good Manager Anyway?

    Type
    Blog Post
    ...of the manager is not to empower but to remove obstacles.” – Scott Adams, Dilbert cartoonist What makes...for example. So aside from a focus on removing obstacles, what makes a good manager? First, it takes an...their present positions By removing the primary obstacle of job dissatisfaction, the work can get done,...blogs in this series will address more specific tactics managers can utilize to be in touch with the needs...
  9. Multifunctional Neural Fibers: Modulation from Gut to Brain

    Type
    Blog Post
    ...named NeuroStack was used (Orguc et al., 2020). Using a programmable microcontroller, NeuroStack coordinates...rechargeable battery, is relatively small, and can be detached easily whenever necessary. This is all an impressive...tissue. They performed optical stimulation using NeuroStack and the fibers as previously described, then ...
  10. The Importance of High Titer for AAV Transductions

    Type
    Blog Post
    ...this post for a refresher on AAV titers Making contact with a cell Although an individual AAV particle...to infect a cell, it has to come into physical contact with that cell. Since there is a limited amount... area on each cell, the way to get more AAV in contact with the cell is to increase the AAV concentration...expression It’s clear that we need high titers, as contact between the cell and any individual AAV particle...
  11. Plasmids 101: Transformation, Transduction, Bacterial Conjugation, and Transfection

    Type
    Blog Post
    ... or sex pilus that attaches to the recipient cell drawing it close. Once in contact the donor can transfer...viral vector. One example are bacteriophages that attach to bacterial membranes and inject their genetic...bacterium to a recipient bacterium through direct contact. The donor bacterium contains a DNA sequence called...
  12. Tips for Technical Support Calls

    Type
    Blog Post
    ...biology-related customer support interaction. Before contacting customer service In an age of Tweeting and texting...customer service experience: Make sure you’re contacting the correct company. This might seem like a no-brainer...questions. BUT, I do believe that scientists who contact customer service deserve prompt, courteous responses...responses. No one is likely to look forward to contacting customer service, but the experience should never...
  13. The Scientific Conference Poster Session: Tips for Success

    Type
    Blog Post
    ...up your poster, and pack a few business cards to tack up next to your poster. Arrive early: You might ...well ahead of time ensures you aren’t scrambling to tack up your poster seconds before the session begins...popular posters at the end of the session. Get in contact See a poster you want to know more about? Interested...related to your research? Find a way to get in contact with the presenter after the session. Exchange ...
  14. Plasmids 101: Degron Tags

    Type
    Blog Post
    ...proteolysis-targeting chimera (PROTAC) was developed for HaloTag. PROTACs are engineered molecules which...self-cleave and the protease and degron remain attached to the tagged protein. In this event, the degron...it is a straightforward system – HaloTag and its PROTAC are all that is needed to facilitate degradation...
  15. Addgene's Cancer Collection Pages Connect the Research Community

    Type
    Blog Post
    ...Despite these grim statistics, new strategies for attacking cancer are yielding promising results in the laboratory...universally-dividing behavior of cancer cells, attacking the cellular machinery necessary for division....technologies become available almost daily, yet obstacles remain. One of the biggest challenges facing researchers...Pathway v2.0 Page Resources on the Addgene Blog Tackling Cancers' Drug Resistance with a New Screening ...
  16. Career Insights: Technical Support Specialist

    Type
    Blog Post
    ...absolutely convinced it was the company’s fault. I contacted them to express my concerns and request a replacement...customer support conversation, just go ahead and contact a technical support team with a question or two... for asking a quick question or making initial contact, but is less suitable for troubleshooting or issuing... friendly, patient, attentive, empathetic, and tactful. Occasionally it can also be necessary to take ...
  17. March for Science

    Type
    Blog Post
    ...advocacy will be required. Information on how to contact your representatives in case you would like to ... them about science: Representatives: To find contact information for your representative in the House...need to know is your area code. Senators: To find contact information for your senators all you need to do...state. State Legislatures: To find the website to contact representatives at the state level you can click...
  18. Congrats to the 2019 Deck The Lab Winners

    Type
    Blog Post
    ...tape garland. Thanks @ribosholmes!   Frogs and tacos The Miller Lab at the University of Michigan decorated... sweaters and Santa hats. There was even a giant taco... Miller lab annual #DeckTheLab. Getting in the...frog is coming to town. @Addgene @UMich_MCDB #christmastaco #frogsnowflake #xenopus #ASCBEMBO19 #MCDB 🎄...
Showing: 41 - 60 of 363 results