We narrowed to 12 results for: tac
-
TypeGuide...terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG (Waugh lab) Tac promoter, forward primer...primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning ...-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer Full Primer ...5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence...sequence, forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1...
-
Optogenetics Guide
TypeGuide...channel variants from other species include: GtACR1 and GtACR2 (from the cryptophyte Guillardia theta ). ... mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia theta...that bind to the LOV domain only in the dark. attaching only one member of the Zdk/LOV2 pair to the target... -
Antibody Guide
TypeGuide...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...direct ELISAs, an antigen or protein of interest is attached to the well of a 96-well plate. A conjugated primary...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done...are assayed and the extracellular matrix remains intact. The signaling molecule may be a fluorophore or... -
Molecular Biology Reference
TypeGuide...purposes of isolating one specific DNA sequence. This obstacle has been overcome by the field of recombinant ...barcode, and amplified. These DNA fragments are attached to a glass slide so that different fragments of...are spatially separated from each other. These attached DNA templates are then amplified again producing... -
Chemogenetics Guide
TypeGuide...inhibition Tung et al., 2015 iLMO: GeNL_SS- hGtACR1 GeNL_SS hGtACR1 CFz Cl - influx Neuronal inhibition Ikefuama... -
Lentiviral Vector Guide
TypeGuide...different plasmids, the viral genome remains largely intact. First-generation plasmids include (Figure 2): ...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks... -
Adeno-associated virus (AAV) Guide
TypeGuide...elements are needed. One strategy to overcome this obstacle, has been to use smaller Cas9 orthologs, such ...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks... -
Promoters
TypeGuide...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter ... -
Cloning
TypeGuide...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of DNA sequence. This fragment... -
Gamma-Retroviral Vector Guide
TypeGuide...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks... -
Adenovirus Guide
TypeGuide...with most experiments, infection risks occur with contact to mucous membranes or broken skin. The risk of... -
CRISPR Guide
TypeGuide...Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya, R. P., Livny, J., Regev, A., Koonin, E. V.,...