We narrowed to 12 results for: tac

...Reverse Tac promoter GAGCGGATAACAATTTCACACAGG Tac promoter Forward tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end...-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ATAATACCGCGCCACATAGC 5' end of...Forward pACYC-F TGAAGTCAGCCCCATACGAT p15A origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites...pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter Forward pcDL-F GTTGCCTTTACTTCTAGGCCT 5' of EcoRI...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end... Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward (-...GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG...

...channel variants from other species include: GtACR1 and GtACR2 (from the cryptophyte Guillardia theta ). ... mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia theta...that bind to the LOV domain only in the dark. attaching only one member of the Zdk/LOV2 pair to the target...

...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...direct ELISAs, an antigen or protein of interest is attached to the well of a 96-well plate. A conjugated primary...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done...are assayed and the extracellular matrix remains intact. The signaling molecule may be a fluorophore or...

...of recombinant DNA technology has overcome this obstacle by enabling the preparation of more manageable...barcode, and amplified. These DNA fragments are attached to a glass slide so that different fragments of..., or templates, are spatially separated. These attached DNA templates are then amplified again, producing...

...inhibition Tung et al., 2015 iLMO: GeNL_SS- hGtACR1 GeNL_SS hGtACR1 CFz Cl - influx Neuronal inhibition Ikefuama...

...different plasmids, the viral genome remains largely intact. First-generation plasmids include (Figure 2): ...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks...

...elements are needed. One strategy to overcome this obstacle, has been to use smaller Cas9 orthologs, such ...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks...

...tryptophan Promoter from E. coli tryptophan operon Ptac Constitutive Hybrid promoter of lac and trp; constitutive...

...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This...

...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks...

...with most experiments, infection risks occur with contact to mucous membranes or broken skin. The risk of...

...Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya, R. P., Livny, J., Regev, A., Koonin, E. V.,...