Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 130 results for: tac promoter

Showing: 41 - 60 of 130 results

  1. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ... °C. Pro-Tip Different brands and FBS lots can promote or inhibit transfection. Test a variety of brands...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter...

  2. INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons

    Type
    Blog Post
    ... VchINT, three separate plasmids and multiple promoters were used to express the necessary components ...required genes and the CRISPR RNA under the same promoter, and a donor plasmid (pDonor) encodes the mini-transposon...randomly, or at fixed genomic target sites.  This obstacle was recently surpassed with the discovery of CRISPR-transposons...

  3. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...contains a reporter gene cloned downstream of a promoter containing the target sequence of the DBD. The...as the “prey”) in close enough proximity to the promoter of the reporter gene to activate expression (Figure...2547163. 5. Ozawa, T., Kaihara, A., Sato, M., Tachihara, K., Umezawa, Y.l. Split luciferase as an optical...

  4. Interview: Hodaka Fujii on enChIP, New CRISPR Tools, and More

    Type
    Blog Post
    ...hesitation. I hope I will be able to effectively promote Addgene, which is also beneficial to my research...Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using...merit of depositing plasmids to Addgene has been spectacular. We've got more than one hundred requests, and...

  5. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a ... start of my target sequence? A3: The human U6 promoter prefers a 'G' at the transcription start site ...of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains...Ran et al. (2013). In the case where you have intact CRISPR protospacer target in the HR template, you...in my HR template an issue? A8: Yes. If you have intact protospacer+PAM sequence within the HR template...

  7. Adeno-associated Viruses (AAVs) for Genome Editing

    Type
    Blog Post
    ... vector is inserted downstream of a functional promoter (gene traps). The resultant gene targeting system...pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify these tagging vectors...pAAV-SEPT-Acceptor, the preferred vector, contains a promoterless splice acceptor-IRES-neoR gene, which enhances...Central PMCID: PMC2577350. 4. Kim, Jung-Sik, et al. "Intact cohesion, anaphase, and chromosome segregation ...

  8. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...transcription by placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores ... RNA Polymerase III. By expressing Corn under promoters for transcripts uniquely transcribed by RNA Polymerase...with DFHBI, but its structure allows for greater contact with its RNA aptamer. This increased interaction...

  9. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to ...Lentiviral Particles Before this step, you must contact your institution’s Bio-Safety office to receive...the OPTI-MEM – do not allow FuGENE® to come in contact with the walls of the tube before it has been diluted... 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous...

  12. Bacterial Expression Systems

    Type
    Collection
    ...coli strain. Addgene Blog Inducible Promoters Repressible Promoters Synthetic Photobiology: Optogenetics...pRU1701 Promoter activity Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity...pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium sp. Tanya Parish 24657 pASTA3 Promoter activity...periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification...Toolkit (Addgene #1000000080) features a library of promoters and purification tags compatible with Golden Gate...temperature, in different bacterial systems. ID Plasmid Promoter Inducer Expression Species PI 44249 pdCas9-bacteria...extorquens Julia Vorholt 84693 pMyNT-kan Acetamidase promoter Acetamide Escherichia coli , Mycobacterium smegmatis...

  14. The Pleiades Promoter Project

    Type
    Collection
    ...Collections Pleiades Promoter Plasmids Pleiades Promoter Project The Pleiades Promoter Project (Link opens...Positive Control CAG promoter pEMS1293 cre N/A CAG promoter pEMS1164 EGFP/cre N/A CAG promoter pEMS1114 EGFP/...NLS N/A CAG promoter pEMS1157 EGFP/NLS N/A CAG promoter pEMS1277 EGFP/NLS N/A CAG promoter pEMS1294 intron-lacZ...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective expression...mouse brain through these human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below...intron-lacZ/NLS N/A CAG promoter pEMS1488 intron-lacZ/NLS References Portales-Casamar, E., Swanson, D....Ple216 TAC1 pEMS1262 EGFP/NLS Ple217 TAC1 pEMS1263 EGFP/NLS Ple218 TAC3 pEMS1181 EGFP/NLS Ple219 TAC3 pEMS1182...

  15. Brain Initiative Collection

    Type
    Collection
    ...-mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 75033-AAV9 pAAV CD68-hM4D(Gi)-mCherry...mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell...An AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed...Cre-dependent expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed...recombinase-dependent expression of mNeonGreen from the CAG promoter Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA...expression of the fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An...expresses the fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-AAV5 pAAV-CAG-eYFP An...

  16. Validated gRNA Sequences

    Type
    Collection
    .... pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949... CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter...S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949...S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...pyogenes 25161212 Fire sv40 promoter synthetic CATACTTCTGCCTGCTGGGGAGCCTG 62338 activate/interfere S. ... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...

  17. Celebrate Open Data Day with Addgene’s AAV Data Hub!

    Type
    Blog Post
    ...the database by certain features like serotype, promoter, or tool type and each entry contains an image... data or lab notebook handy?  Contact info: Give us your contact information so we can follow up with...

  18. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ... and partial gene deletion, overexpression (by promoter substitution), and tagging at either the N- or... in epitope tags? Others may be interested in attaching epitope tags to their genes of interest, allowing...

  19. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...connecting patients to important resources and promoting research for rare disease cures. Through their...animals models of the disease in partnership with Taconic Biosciences. The study of peritoneal mesothelioma...
Showing: 41 - 60 of 130 results