...' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab... Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...Forward CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A...vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for...Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG...

...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway...Plasmid 101: Golden Gate Cloning ) Back to Top Ligation Independent Cloning Ligation Independent Cloning...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...degrade over time, further reducing ligation efficiency. TOPO® ready Gateway® Entry plasmids are also available...Type IIS Assembly (Golden Gate & MoClo) Type IIS systems, such as Golden Gate and Modular Cloning (MoClo...

...winners’. Negative Screen Negative screens are a little trickier than positive screens. In a negative screen...false positives or false negatives in later experiments, and can also negatively affect data reproducibility...random chance that could lead to false positive or negative results - for a given plasmid, think of each cell...be divided into two types: positive screens and negative screens. Both types of screen employ a selection...pooled library to cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection... Get a list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...

...experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod shaped bacteria naturally...Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly used for plasmid...another by a type of horizontal gene transfer (conjugation), usually providing a benefit to the host, such... E. coli , it is replicated independently and segregated to the resulting daughter cells. These daughter...recognition site. These elements allow for the propagation of the plasmid within bacteria, while allowing...bacteria with plasmids, thus selecting against the propagation of these plasmids through cell division. To ensure...insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS is often located...

...restriction sites but compatible with the Gateway® cloning system? Gateway® compatible vectors use recombination...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival...site, one can use standard cloning techniques to ligate the insert into this site. If it is not immediately... insert of interest from its parent vector and ligating into a second vector in such as way that the insert...in the vector into which one ultimately wants to ligate the insert. Often times it is less time consuming...ends of the primers used. Alternatively, you could ligate a multiple cloning site (MCS) from a separate vector...Invitrogen's website for more information on the Gateway® cloning system. What safety concerns surround ...

... Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb light at specific...ChRs. These ChR variants still function as light-gated, cation channels resulting in excitation (depolarization...identified in other species - by acting as light-gated chloride channels, these variants result in the ...plasmids . Halorhodopsins Halorhodopsins are light-gated inward chloride pumps isolated from halobacteria...Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii (CrChR2...a transgenic mouse line, such as for example the VGAT-ChR2 mouse, where ChR2 is expressed under the control...vesicular gamma aminobutyric acid (GABA) transporter (VGAT) and ChR2 is thus expressed in all GABAergic neurons...

...using Chemogenetics plasmids in your lab for interrogation of neuronal activity....coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either excite or inhibit...neuronal activity. Figure 3: PSAM4-based ligand-gated ion channels, their effect, and outcome in neurons...Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate brain functions. Annu Rev Neurosci. 37:378–407...DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron. 86:936–46. PMID: 25937170...

...together. Operon regulation can be either negative or positive. Negative repressible operons, are normally bound...Constituitve Strong mammalian promoter from human elongation factor 1 alpha CAG Constitutive Strong hybrid...The Lac operon in bacteria is an example of a negatively controlled operon. A positive repressible operon...

...concentration of recovered DNA . Ligate Your Insert Into Your Vector Conduct a DNA Ligation to fuse your insert to...also important to set up negative controls in parallel. For instance, a ligation of the recipient plasmid... like... Restriction Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary PCR based cloning...NotI sites to Your Gene of Interest (YGOI) for ligation into a recipient plasmid. Designing Primers for.... In our example, we will use EcoRI and NotI to ligate our cDNA into the recipient plasmid. Remember to...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...recipient vector with a phosphatase prior to the ligation step or prior to the gel purification step, depending...

...Antibody-based applications, which often use antibodies conjugated to a signaling molecule, can be used to capture...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...

...concentration of recovered DNA . Ligate your insert into your vector Conduct a DNA Ligation to fuse your insert to...also important to set up negative controls in parallel. For instance, a ligation of the recipient plasmid...uncut or self-ligating recipient plasmid backbone. Transformation Transform your ligation reaction into... like... Restriction Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary The following...recipient plasmid with a phosphatase prior to the ligation step or prior to the gel purification step, depending...recommend around 100ng of total DNA in a standard ligation reaction. You ideally want a recipient plasmid...concentration alone. One method is to conduct 2 ligations for each plasmid you are trying to create, with...

...your experimental goal, you are ready to start navigating the different reagents that are available for...containing the gRNA scaffold using standard restriction-ligation cloning. However, the exact cloning strategy will...

... how to handle the pipette Watch the Video! Centrifugation Learn about selecting and using a centrifuge...by size on an agarose gel Watch the Video! DNA Ligation Assemble DNA using DNA ligase Bacterial Transformation...Cloning Assemble plasmids by restriction digest and ligation Cloning by PCR Generate restriction sites by PCR...overlapping DNA fragments in a single reaction Ligation Independent Cloning (LIC) Scarless cloning with...choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify adeno-associated virus from a preparation...

..., as they are unable to digest the agar but can gather nutrition from the LB within. The addition of an...our sample data section below for positive and negative test results. Sample Data In all cases below (...should always check for contamination prior to use. Negative Result 1: Both Strains Grow Assuming the appropriate...antibiotic at too low a concentration for selection. Negative Result 2: Neither Strains Grows If neither strain...both strains on plates without any antibiotic. Negative Result 3: Only the Non-resistant Strain Grows ...

... between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an annealed oligo insert of 50bp in... like... Restriction Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary Oligo overlap... Then, gradually cool to 25°C over 45 minutes. Ligation Dilute 5μL of annealed oligos with 45μL nuclease-free...

...Enzyme Digest Restriction Digest of Plasmid DNA DNA Ligation Introduction Transformation is the process by ...efficiencies will be approximately 10-fold lower for ligation of inserts to vectors than for an intact control...volume is too big, gently collect the cells by centrifugation and resuspend in a smaller volume of LB so ...cells. If you used 100-1000 ng of total DNA in a ligation you will often get more colonies if you use 1 ...

...and voltage. Note: Black is negative, red is positive. The DNA is negatively charged and will run towards...Plasmid DNA Purifying DNA from an Agarose Gel DNA Ligation Introduction Gel electrophoresis is the standard...Electrophoresis uses an electrical field to move the negatively charged DNA through an agarose gel matrix toward...

...Cloning by PCR Restriction Digest of Plasmid DNA DNA Ligation Background Information A standard Polymerase Chain...step enables the DNA polymerase to synthesize and elongate the new target DNA strand accurately and rapidly...nucleic acid that are starting points for DNA elongation and synthesis. Taq DNA polymerase: Special DNA...

...all subsequent centrifugation step Pro-Tip Resin will appear compacted after centrifugation. Discard the... concentration is still too low, repeat the centrifugation until the volume of the sample is reduced enough...

...recombinant antibody Isotype control antibody HRP-conjugated isotype-specific secondary antibody ELISA 96-...the wash buffer from the wells. Dilute the HRP-conjugated isotype-specific secondary antibody to the desired... human recombinant purified Desmin (blue) or a negative control protein, Apolipoprotein L3 (red) overnight...