We narrowed to 663 results for: cat.2

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

...biology 14.6 (2004): 757-764. PubMed PMID: 15582400. 2. Tomkinson, Alan E., et al. "DNA ligases: structure...or DNA base pair mismatches (8-11). For some applications, there cannot be any end-joining activity, and...regions. Why use a high fidelity ligase? Numerous applications have been developed to take advantage of the...Taq and other thermostable DNA ligases. These applications detect specific nucleotide sequences with high...rounds of melting and annealing allows linear amplification of the probe ligation product. With the right...uses two sets of probes to achieve exponential amplification. What does fidelity mean for a ligase? DNA ligases...conditions to be screened per plate. The results indicated that the optimal buffer for Taq DNA Ligase contains...

...transfer, block, incubate with primary antibody Day 2: Incubate with secondary antibody Video Watch this... Microcentrifuge 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...Heat block Mini gel tank chamber Power supply iBlot 2 Gel Transfer Device Roller Spatula Platform shaker...running buffer Prestained protein ladder Ethanol iBlot 2 PVDF Mini Stack, Thermo Fisher IB24002 20X TBS Tween...immediately or store at -80 °C until ready to use. Section 2: Determine the total protein concentration and prepare...in deionized water. To prepare 20% ethanol, dilute 2 mL of ethanol into 8 mL of deionized water and mix...the transfer sandwich as follows: Unseal the iBlot 2 PVDF Mini transfer stack. Set the Top Stack to one...

...effective recovery of knock-ins, but did result in 1-2 kilobases of additional sequence being introduced....Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...

...method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over V_T}$$ Where: T = Titer...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ...Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace with fresh media Day 4...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension into each well of the 6-well...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...

...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo...

... recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the... day to ensure that growth times are limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 ... Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate transformations...has been absorbed by the agar. This usually takes 1-2 minutes. Critical Be careful not to rip or shred the...incubation if needed. Place 100 mL sterile LB at 4 ℃. Day 2 (morning) Before beginning, prechill at least four...pellet. The total weight of each pellet should be ~1-2 g. Pro-Tip Make sure to weigh the empty tube beforehand... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...

...vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4...with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...serial dilutions of the purified antigen as follows: 2 ng/µL : Add 100 µL of 20 ng/µL stock into 900 µL PBS...microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS in a microfuge tube and...37 °C for 30 min , or overnight at 4 °C . Section 2: Block the plate Prepare the wash buffer (0.05% Tween...incubate on a microplate shaker set to 400 rpm for 2 h at room temperature or overnight at 4 °C . Section...

...mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH 2 O to 400 mL Note: If your lab has pre-mixed...start 2 mL in a Falcon tube. For larger preps, you might want to use as much as a liter of LB in a 2 L Erlenmeyer...antibiotic. Unless otherwise indicated, the antibiotic powder can be dissolved in dH 2 0. Addgene recommends ...individual plasmid within a single bacterial cell (Figure 2). Large plasmids usually have a low copy number (approximately...determine if your plasmid is high or low copy. Figure 2: High versus low copy plasmids in bacteria. Created...

...Warnings HEK293 cells are considered biosafety level 2. Please ensure that you are in compliance with your... 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest...conical tubes Automated cell counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 ...250 mg Benzamidine 25 mL Aprotinin saline solution (2 mg/mL) Mix well and sterilize through a 0.2 µm PES... a 500 mL vented flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip... not use cells that are over 30 passages. Section 2: Transfection Check the cell density and viability...the culture. Pro-Tip Culture should be between 1.5–2 x 10 6 cells/mL with >95% viability to proceed with...

... glacial acetic acid 57 mL of dH 2 O Store Solution III at 4°C Grow 2 mL overnight cultures from single...Resuspension buffer Denaturing solution Renaturing solution 2 mg/mL RNase A TE or water-saturated phenol-chloroform...100 μL of cold Solution I. Vortex the solution for 2 min or until all bacteria are fully resuspended. Add...pipetting or carefully pouring. Optional: Add 5 μL of 2 mg/mL RNase A to the supernatant in the new tube and... to the recovered aqueous DNA layer. Repeat steps 2-4. Note: Phenol-chloroform is a hazardous waste - ...: Ethanol Precipitation To your DNA solution, add 2-2.5 volumes 95% or 100% ethanol and 1/10 volume of... Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and Isolating Bacteria Inoculating...

...violet and counted. Figure 2: A549 cells were transduced with the indicated serial dilutions of the lentiviral...Workflow Timeline Day 0: Seed and transduce cells Day 2: Replace media with fresh media containing selection...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...the appropriate antibiotic. Incubate the cells for ~2 weeks. All of the cells in the untransduced (negative...disturb the colonies. Count the colonies for at least 2 of the dilutions. Pro-Tip The higher dilution wells...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1%...

...RNAzol®, QIAzol® (for Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl....5% (wt/vol) N-laurosylsarcosine (Sarkosyl) 0.1 M 2-mercaptoethanol TRIzol® or similar product such as...recipe). If using TRIzol®, jump down to the Option #2 - TRIzol® Protocol section below. Homogenize or lyse...following sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion...aliquots of it and storing those in -80°C. Option #2 - TRIzol® Protocol Homogenize or lyse tissues or cells...by hand for 10 seconds. Incubate the sample(s) for 2-3 minutes on ice and centrifuge for 15 minutes at ...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...

...BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs Watch the...Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the Video! Water...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...

...temperature between 50-60°C for your PCR primers. Step 2: Linearize Vector In this example, the vector is cut...20-30 Eluted DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4...your treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing... reaction is now ready for transformation. Use 1-2 μl of annealing reaction for each transformation, ... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...mixture by gel electrophoresis followed by gel purification . The cut vector end will now look like this...

...agarose concentrations (e.g., 2 g of agarose in 100 mL of TAE will make a 2% gel). Mix agarose powder with...gels are commonly used in concentrations of 0.7% to 2% depending on the size of bands needed to be separated...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr binds...allows you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases... length in base pairs) for visualization and purification. Electrophoresis uses an electrical field to...instructions on how to do this, visit the Gel Purification page. Tips and FAQ How do you get better resolution...

...each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 30-60 ...cells you are using). Put the tubes back on ice for 2 min. Add 250-1,000 μl LB or SOC media (without antibiotic...instead of on ice Reduce step 4 from 20 - 30 mins to 2 mins on ice before heat-shock Shorten or skip the ...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...

...Day 1: Seed individual cells in a 96-well plate Day 2–14: Monitor cells for growth and expand cells Day ...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...channel pipette 200–1000 µL single channel pipette CO 2 incubator Pipet controller Hazardous waste container...approximately 50–60% confluent. For 293T cells this is about 2 × 10 6 cells in a 10 cm dish. Each 10 cm dish should...the highest or lowest transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal ...inferred by the differences in colony size. Figure 2: Cas9 expression in monoclonal cell lines generated...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...

...Workflow Timeline Day 0: Seed and transduce Cells Day 2–3 (am): Remove media, replace with fresh media containing...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...cell death, the cell media should be changed every 2–3 days to maintain the dose of antibiotic, which may...confluent 10 cm dish can be expanded into two 75 cm 2 flasks, etc. Pro-Tip This selection method results...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...

...Fluorescent microscope 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino-2-phenylindole (DAPI) Bovine serum albumin (BSA) Triton...grow to the desired density before labeling. Section 2: Fixing and permeabilizing cells Gently aspirate the...of the diluted antibody to the wells and incubate 2 h at RT . Remove the primary antibody and dispose ...Guide Western Blot Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is...as methanol or acetone may be better for some applications. Remove the paraformaldehyde and follow your...