We narrowed to 771 results for: LIS
-
TypeBlog Post...system, as is commonly used in western blotting or ELISAs. A popular method for indirect labeling employs...
-
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post....0, with the goal of overcoming the limitations listed above. First, they screened a variety of fluorescent... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post... H., Dumitras, C., Gong, B., Nguyen, K., Van Der List, D., Murray, K. D., Engebrecht, J., & Trimmer, J... -
Plasmids 101: Dimers and Multimers
TypeBlog Post...forms of colicinogenic factor E-1 from Proteus mirabilis. Biochemistry. 1968 Oct;7(10):3513-20. doi: 10.1021... -
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post... genome. However, with only 3.4% of founders establishing germline transmission of the transgene, this... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...A list of zebrafish genes and associated pairs of zinc finger arrays that can be used to generate ZFNs... for Endogenous Zebrafish Gene Targets Recent published reports have shown that engineered zinc finger...targeted to various zebrafish genes. The table below lists zebrafish genes and associated pairs of zinc finger...details). IMPORTANT NOTE: All zinc finger arrays listed show transcriptional activation activity of three-fold... -
Worm Expression Resources
TypeCollection... not included in this table. For a more complete list of plasmids that can be used in worms, search Addgene's...Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great plasmid tools for the community... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Zebrafish Plasmid Collection
TypeCollection... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the... Tracing during Development and Regeneration - Periklis Pantazis Lab Multibow: digital spectral barcodes...optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard White ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...plating, etc. Be wise to choose any of the techniques listed below and always use a second assay to be 100% ... -
Finding Your Science Policy Path
TypeBlog Post...connect to your why. I suggest this crowdsourced list of foundational texts as a starting point. Assess... -
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post...PMCID: PMC3225502. Boyden, Edward S., et al. "Millisecond-timescale, genetically targeted optical control... -
When Fidelity Matters: A frank discussion about ligase fidelity
TypeBlog Post...New England Biolabs® (NEB) researchers recently published a method for the high-throughput profiling of ... -
Deep Dive: Statistical Tests (Comparisons)
TypeBlog Post... of comparisons. The Bonferroni does this by establishing a significance threshold at a p value less than... -
Ras Pathway
TypeCollection...Pathway Background Ras Pathway Plasmids Ras Gene List Resources Background Ras is a small GTPase and is...available plasmids for the gene, or browse the gene list below. For proteins with multiple subunits or isoforms...Cancer Research Return to top Ras Pathway - Gene List Click on a name to find available plasmids for the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Validated gRNA Sequences
TypeCollection... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...doing routine PCR assays. Here is a simple to-do-list to follow when planning epitope tagging experiments... -
Selecting Your Plasmid Purification Kit
TypeBlog Post...manufacturers. It also includes a rough comparison of list price between these manufacturers, as price is a... -
Synthetic Biology - Browse Plasmids
TypeCollection...A list of Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs....Standards SynBio Blog Genome Engineering Browse the list of available plasmids related to synthetic biology...are plasmids you would like to see added to this list, please email [email protected] . Synthetic Biology... -
TALEN Expression Vectors
TypeCollection...Daniel Voytas Lab plasmids CRISPR plasmids This page lists plasmid vectors into which DNA fragments encoding... products are the same). All expression vectors listed below have the CMV promoter for mammalian cell ...at their amino-terminus. The expression vectors listed below can be purchased together with the Joung ... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...present in many circulating variants. The table below lists expression plasmids that are suitable for generating...measuring infectivity and neutralizing activity are listed below: pBOBI-FLuc - Lentiviral reporter vector ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...