We narrowed to 735 results for: RAN-1

...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved...can be motifs within transmembrane proteins, such as receptors, or post-translational modifications on those...diffuse through the cell membrane freely, while others require a permeabilized membrane to enter cells. Depending...label intranuclear proteins of interest, you can label cytosolic proteins alongside the intranuclear ones...Depending on the application, they can be membrane-permeant or membrane-impermeant, and the cells of interest...viability dyes are membrane-impermeant and can only enter cells with compromised plasma membranes — i.e., dead...conjugates are commercially available for a wide range of fluorophores, allowing for great flexibility ...

...determined for your sample. Typical ratios may range from 1:1 to 1:6. Add the diluted PEI-MAX to the diluted...solution at -20 °C. 1 mg/mL PEI-MAX Add 1 g of PEI-MAX powder to 900 mL deionized water in a 1 L bottle and ...to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second tube of 6 mL BCD TFX (for a 1 mg/mL stock solution ...antibody At 168 hours (1 week) post-transfection, harvest the antibody. Transfer the HEK293 cells and media...February 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest...at -20 °C. Procedure Section 1: Seeding cells The day prior to transfecting, seed a 108 mL culture of HEK293.... Cap the tubes and incubate for 1 h in the 37 °C bead bath. Transfer the PEI-MAX and recombinant antibody...

... phototropin 1 LOVETRAP reversibly sequester and release proteins from cellular membranes using light....algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used...

...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...

...get more colonies if you use 1 μl of a 1:5 or 1:10 dilution rather than 1 μl directly.... 20-30 mins. Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42...and then (optional) incubate in 37°C incubator. Mix 1 - 5 μl of DNA (usually 10 pg - 100 ng) into 20-50 ...Introduction Transformation is the process by which foreign DNA is introduced into a cell. Transformation of bacteria... more easily transformed and that will help to maintain the plasmid without rearrangement of the plasmid...prepared for optimal transformation efficiencies upon thawing. For the highest transformation efficiency, we...Pro-Tips Commercial competent cells range significantly in their transformation efficiency. The lowest efficiency...

...mycoplasma can even escape 0.2-micron filters. Figure 1: Contamination! Tissue culture media often have indicators..., and effective for wide range of mycoplasma. These methods cannot guarantee complete removal of mycoplasma...the media after autoclaving hence, there is no assurance of the serum being contamination free. The aerosols...commonly infecting mycoplasmas are used. A broad range of primers encompasses almost all the infecting ...filters, for media filtration. There is no 100% assurance that this process can avoid contamination but ...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...

...expression of the full-length transgene, but also at a very low efficiency (less than 1% of wild-type). Another...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...

...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...flow of electric charges across cell membranes and maintain membrane potential in response to visible light...across the axon's membrane: once a certain number of positive ions crosses the cell membrane, a threshold ...rhodopsins enable ions to flow across the axon’s membrane, thereby controlling neural activity (Bernstein...the opsin into the correct orientation to be transcribed (Figure 2) (Sharma and Zhu, 2014). How does FLEx... optogenetic FLEx vectors in combination with transgenic animals or rAAVs expressing Cre under a specific...the mechanisms of sleep and anesthesia. In Cre transgenic mice, they targeted the dopamine (DA) neurons...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...

...a short-term position (1-2 years) Often a gap-year position taken to transition to the next career stage...investigator. In basic science (as opposed to translational, biomedical, or applied sciences), people conduct...don’t tell us everything there is to know is a strange and exciting revelation. Science in any field can...investigator (PI) Runs the lab Writes a lot of grants Varying degrees of engagement with what happens...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...project to validate some genomic changes, so this arrangement was ideal for everyone.  The cutting edge science...young scientists and PhD students to also explore a range of alternative careers outside of acidemia to have...

...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...

...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ...Barcoding libraries contain plasmids with unique, semi-random sequences that can be used for applications like...large numbers of cells minimizes the effects of random chance that could lead to false positive or negative...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...

...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication...

...Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO.1 B.1 Determine the optimal...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...convenience. See “warranty information” in appendix. Table of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi...

...ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided high transfection efficiencies...possible range of ratios to test: Ratio of DNA:PEI μg of DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8... 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4 Gently add the diluted PEI mixture to the...: Monday: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Wednesday: Plate 1×10 6 cells in a...packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection. Remove media, replace...ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid pHAGE TRE dCas9-KRAB...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1-2 days ...

...Dilution 1:10 100 of Stock Virus 900 150 1,350 1:100 1:100 100 of 1:10 900 150 1,350 1:1,000 1:1,000 100...100 of 1:100 900 150 1,350 1:10,000 1:10,000 100 of 1:1,000 900 150 1,350 1:100,000 1:100,000 100 of 1... 1:10,000 900 150 1,350 1:1,000,000 Mix the dilutions well Note: the 1:10 dilution can usually be omitted...with 1 mL of 0.1% crystal violet for 10 min at RT. Gently remove the stain. Wash cells 3x with 1 mL of...multiple dilutions. Sample Data Figure 1: A549 cells were transduced with the indicated serial dilutions ... media from the wells. Gently wash the cells with 1 mL of PBS and aspirate wash. Filter 0.1% crystal violet...volume in the well (mL) x dilution factor e.g., If the 1:100,000 well has 75 colonies, then there are 75 colonies...