Skip to main content

We narrowed to 755 results for: cat.1

Showing: 721 - 740 of 755 results
  1. AAV ddPCR Titration

    Type
    Protocol
    ...Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400)...95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold 4 ...Use a single channel 1–10 µL pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution... 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer (1:160,000) Dilution 5 (20X...95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in 50 µL 1X PCR buffer (1:6,400,000) Dilution ...50 µL 1X PCR buffer (1:12,800,000) Dilution 8 (2X): 50 µL in 50 µL 1X PCR buffer (1:25,600,000) Use multichannel...pipettes for the dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For...
  2. AAV Production in HEK293 Cells

    Type
    Protocol
    ...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ...Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with 2 mg total DNA per CS5 Plasmid ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine ...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice between...C before proceeding with the purification protocol. Sample Data Figure 1: HEK293T cells at various confluencies...
  3. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...from 1:1 to 1:6. Add the diluted PEI-MAX to the diluted DNA. Cap the tube and vortex with three 1 s pulses...solution at -20 °C. 1 mg/mL PEI-MAX Add 1 g of PEI-MAX powder to 900 mL deionized water in a 1 L bottle and ...to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second tube of 6 mL BCD TFX (for a 1 mg/mL stock solution ...Last Update: February 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells... a time. Add deionized water to a final volume of 1 L and recheck pH to ensure that it has not drifted...Aliquot and freeze upright at -20 °C. Procedure Section 1: Seeding cells The day prior to transfecting, seed...of two 50 mL tubes. Cap the tubes and incubate for 1 h in the 37 °C bead bath. Transfer the PEI-MAX and...
  4. Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs

    Type
    Protocol
    ...both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs working...(PPE) for BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs...Labs Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more ...BSL-2 includes all of the precautions needed in BSL-1, however there are additional precautions that lie...always wear glasses/goggles in addition to the BSL-1 requirements. Conclusion Although simple, following...choose to reuse or repurpose this SOP in another location, please note that you do so at your own risk; ...
  5. Fluorescence Titering Assay

    Type
    Protocol
    ...polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:50 30 1468.5 1.5 1:75 20 1478.5 1.5 1:100 15 1483.5...the dilution factors (method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over ...regulations. Workflow Timeline Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace...for 48–72 h. Gently aspirate media and replace with 1 mL of PBS. Calculate the fraction of fluorescent-positive... example: If 150,000 cells were transduced in the 1:100 well, resulting in 25% fluorescent cells, then...average of multiple dilutions. Sample Data Figure 1: 293T cells were transduced with a range of dilutions... these cells can still be used in downstream applications. Safety Warnings Lentivirus is generally considered...
  6. Lentivirus ddPCR Titration

    Type
    Protocol
    ...95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold 4 ... primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 .... Last Update: July 7, 2023 Workflow Timeline Day 1: Seed and transduce cells Day 4: Treat cells with ...Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1–10 µL single channel pipette 20–200 µL single channel...TrypLE, Thermo Fisher, 12605010) Ethanol, VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10... each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well...
  7. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...June 14, 2023 Workflow Timeline Day 1: Run SDS-PAGE and stain gel Day 1 or later: Image analysis Video Watch...lane Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 ...mobility of the bands (sample AR0016 in Figure 1) indicates that the samples may not have been processed...antibodies using Coomassie stain. Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel...deionized water. Gently invert to mix. Procedure Section 1: SDS-PAGE Add 5 µL of 4X sample buffer to each sample...attach to a power supply. Run the gel at 150 V for 1 h . Pro-Tip If the samples are running unevenly and...Add 20 mL of SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour...
  8. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... provides information for both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of...guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...Safety for Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols...each level has different safety requirements. BSL-1 is designated for those working with microbes that...BSL-2 includes all of the precautions needed in BSL-1, along with additional precautions to prevent injuries...container Fire blanket Fire extinguisher Guidelines BSL-1 Guidelines Before You Work Right after entering the...hygiene officer. BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed...
  9. Ligation Independent Cloning

    Type
    Protocol
    ...DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase... treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing...collection of empty LIC cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often...reaction for 5 minutes at room temperature, then add 1 μl of 25 mM EDTA, followed by another 5 minutes at...The reaction is now ready for transformation. Use 1-2 μl of annealing reaction for each transformation... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...
  10. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...restriction digestion reaction could look like this: 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer...definition: one unit of enzyme will cut 1 µg of DNA in a 50 µL reaction in 1 hour. Using this ratio, you can .... For diagnostic digests, 1-2 hours is often sufficient. For digests with >1 µg of DNA used for cloning...requires 1 µg of DNA. The total reaction volume usually varies from 10-50 µL depending on application and ... for 1 hour. Always follow the manufacturer’s instructions. Pro-Tip Depending on the application and the...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...
  11. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...avoid breathing in the vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody... Spectrophotometer compatible with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel... µL, VWR 76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4...Warm reagents to room temperature. Procedure Section 1: Prepare the Antigen Standard and coat the plate Dilute...stock into 900 µL PBS in a microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS...microfuge tube and vortex. 0.5 ng/µL : Add 450 µL of 1 ng/µL stock into 450 µL PBS in a microfuge tube and... a microplate shaker set at 400 rpm and shake for 1 min . Repeat steps 8–10 twice for a total of three...
  12. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a... if an MOI >1 was used, some cells may have 1 copy of the transgene, while others have >1 copy of the ... well by pipetting or inverting the tube. Aliquot 1 mL of cell suspension (i.e., 50,000 cells) into each... early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines from expansion...transduced with lentiCas9-Blast and then selected with 1 µg/mL blasticidin for 9 days. Single cells were ...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...
  13. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...Because this is such a small volume, first make 1 mL of a 1:100 dilution of the homogenized cell solution... were transduced with lentiCas9-Blast 1 and then selected with 1 μg/mL blasticidin for 9 days. Single ...with lentiCas9-Blast 1 . A549 cells were transduced (MOI = 37) and selected with 1 μg/mL blasticidin for...conditioned medium (see below for more details) Day 1: Seed individual cells in a 96-well plate Day 2–14...final 5 cell/mL solution, transfer 12.5 µL of the 1:100 dilution to 10 mL of conditioned medium. Transfer...cells will appear as colonies in the well ( Figure 1 ). You will be able to tell if there was more than...transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal cell lines from expansion...
  14. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...annealing can be achieved by one of two methods: Method #1 Place the mixed oligos in a 1.5mL microfuge tube. ...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...
  15. Western Blot

    Type
    Protocol
    ...Prepare the chemiluminescence substrate by mixing 1:1 reagent A to reagent B. Gently incubate the membrane...Last Update: January 24, 2022 Workflow Timeline Day 1: Prepare lysates, run SDS-PAGE, transfer, block, incubate...primary antibodies raised in a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at...Gently remove supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube...preferred method for protein determination. Prepare a 50:1 Reagent A to Reagent B dilution of the BCA assay. ...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... vary between antibodies but is typically between 1–10 μg/mL. Incubate the membrane overnight in primary...
  16. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...
  17. Protocol - Bacterial Transformation

    Type
    Protocol
    ...get more colonies if you use 1 μl of a 1:5 or 1:10 dilution rather than 1 μl directly....and then (optional) incubate in 37°C incubator. Mix 1 - 5 μl of DNA (usually 10 pg - 100 ng) into 20-50 ...shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 30...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...
  18. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can...now bind to the primer DNA sequence. Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal ...DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM each nt) 2.5 μL Forward Primer ...primer melting temperature (Tm). Set extension step at 1-2 minutes per kilobase of product depending on whether...working concentration of each primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...
  19. Immunocytochemistry

    Type
    Protocol
    ...Last Update: January 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment...into 5 mL PBS. Protect from light. Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted antibody to the...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled secondary...with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade mounting medium to the microscope...Guide Western Blot Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is...as methanol or acetone may be better for some applications. Remove the paraformaldehyde and follow your...
  20. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...situations where the 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you in...the insert is smaller than the vector) a 3 insert : 1 vector molar ratio will work just fine. We recommend...reagents Optimizing the Vector:Insert Ratio Although a 3:1 insert to vector ratio is usually sufficient, you ...performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent phosphodiester linkages...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation... treated vector Insert or water + Any colonies indicate contamination of intact plasmid in ligation or...
Showing: 721 - 740 of 755 results