Skip to main content

We narrowed to 747 results for: cat.1

Showing: 721 - 740 of 747 results
  1. Ligation Independent Cloning

    Type
    Protocol
    ...DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase... treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing...collection of empty LIC cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often...reaction for 5 minutes at room temperature, then add 1 μl of 25 mM EDTA, followed by another 5 minutes at...The reaction is now ready for transformation. Use 1-2 μl of annealing reaction for each transformation... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...
  2. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...restriction digestion reaction could look like this: 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer...definition: one unit of enzyme will cut 1 µg of DNA in a 50 µL reaction in 1 hour. Using this ratio, you can .... For diagnostic digests, 1-2 hours is often sufficient. For digests with >1 µg of DNA used for cloning...requires 1 µg of DNA. The total reaction volume usually varies from 10-50 µL depending on application and ... for 1 hour. Always follow the manufacturer’s instructions. Pro-Tip Depending on the application and the...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...
  3. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...avoid breathing in the vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody... Spectrophotometer compatible with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel... µL, VWR 76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4...Warm reagents to room temperature. Procedure Section 1: Prepare the Antigen Standard and coat the plate Dilute...stock into 900 µL PBS in a microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS...microfuge tube and vortex. 0.5 ng/µL : Add 450 µL of 1 ng/µL stock into 450 µL PBS in a microfuge tube and... a microplate shaker set at 400 rpm and shake for 1 min . Repeat steps 8–10 twice for a total of three...
  4. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a... if an MOI >1 was used, some cells may have 1 copy of the transgene, while others have >1 copy of the ... well by pipetting or inverting the tube. Aliquot 1 mL of cell suspension (i.e., 50,000 cells) into each... early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines from expansion...transduced with lentiCas9-Blast and then selected with 1 µg/mL blasticidin for 9 days. Single cells were ...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...
  5. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...Because this is such a small volume, first make 1 mL of a 1:100 dilution of the homogenized cell solution... were transduced with lentiCas9-Blast 1 and then selected with 1 μg/mL blasticidin for 9 days. Single ...with lentiCas9-Blast 1 . A549 cells were transduced (MOI = 37) and selected with 1 μg/mL blasticidin for...conditioned medium (see below for more details) Day 1: Seed individual cells in a 96-well plate Day 2–14...final 5 cell/mL solution, transfer 12.5 µL of the 1:100 dilution to 10 mL of conditioned medium. Transfer...cells will appear as colonies in the well ( Figure 1 ). You will be able to tell if there was more than...transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal cell lines from expansion...
  6. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...annealing can be achieved by one of two methods: Method #1 Place the mixed oligos in a 1.5mL microfuge tube. ...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...
  7. Western Blot

    Type
    Protocol
    ...Prepare the chemiluminescence substrate by mixing 1:1 reagent A to reagent B. Gently incubate the membrane...Last Update: January 24, 2022 Workflow Timeline Day 1: Prepare lysates, run SDS-PAGE, transfer, block, incubate...primary antibodies raised in a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at...Gently remove supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube...preferred method for protein determination. Prepare a 50:1 Reagent A to Reagent B dilution of the BCA assay. ...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... vary between antibodies but is typically between 1–10 μg/mL. Incubate the membrane overnight in primary...
  8. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...
  9. Protocol - Bacterial Transformation

    Type
    Protocol
    ...get more colonies if you use 1 μl of a 1:5 or 1:10 dilution rather than 1 μl directly....and then (optional) incubate in 37°C incubator. Mix 1 - 5 μl of DNA (usually 10 pg - 100 ng) into 20-50 ...shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 30...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...
  10. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can...now bind to the primer DNA sequence. Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal ...DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM each nt) 2.5 μL Forward Primer ...primer melting temperature (Tm). Set extension step at 1-2 minutes per kilobase of product depending on whether...working concentration of each primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...
  11. Immunocytochemistry

    Type
    Protocol
    ...Last Update: January 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment...into 5 mL PBS. Protect from light. Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted antibody to the...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled secondary...with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade mounting medium to the microscope...Guide Western Blot Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is...as methanol or acetone may be better for some applications. Remove the paraformaldehyde and follow your...
  12. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...situations where the 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you in...the insert is smaller than the vector) a 3 insert : 1 vector molar ratio will work just fine. We recommend...reagents Optimizing the Vector:Insert Ratio Although a 3:1 insert to vector ratio is usually sufficient, you ...performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent phosphodiester linkages...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation... treated vector Insert or water + Any colonies indicate contamination of intact plasmid in ligation or...
  13. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...Biolabs B7022S Procedure Pouring a Standard 1% Agarose Gel: Measure 1 g of agarose. Pro-Tip Agarose gels are...different buffers and do not use water). Microwave for 1-3 min until the agarose is completely dissolved (but...sample. Note: Loading buffer serves two purposes: 1) it provides a visible dye that helps with gel loading...the way down the gel. A typical run time is about 1-1.5 hours, depending on the gel concentration and ... length in base pairs) for visualization and purification. Electrophoresis uses an electrical field to...instructions on how to do this, visit the Gel Purification page. Tips and FAQ How do you get better resolution...
  14. DNA Quantification

    Type
    Protocol
    ...If using a NanoDrop to measure your samples, place 1-2µL of mini-prepped DNA onto the pedestal. Close the... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...
  15. Pouring LB Agar Plates

    Type
    Protocol
    ...from casein 10.0 g sodium chloride 12.0 g agar-agar 1 L Sterile H 2 O Sterile plates of your desired size...bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in 500 mL bottles. The...measure out 100 mg of ampicillin powder, add it to 1 mL of water, dissolve by vortexing, and filter sterilize... You should not store your plates for longer than 1 month at any temperature and should always check for... for contamination prior to use. Negative Result 1: Both Strains Grow Assuming the appropriate strains...Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated, the antibiotic powder can be dissolved in dH ...test results. Sample Data In all cases below (-) indicates that the tested strain is not supposed to be resistant...
  16. Protocol - How to Design Primers

    Type
    Protocol
    ...fragment that needs to be amplified should be within 1-10 kB in size. The structure of the primer should ...18-24 bases 40-60% G/C content Start and end with 1-2 G/C pairs Melting temperature (Tm) of 50-60°C Primer...primers produce inaccurate, nonspecific DNA amplification product, and long primers result in a slower...which creates primer dimers and disrupts the amplification process. When designing, if unsure about what...
  17. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...cloning. DNA replication by PCR has error rates that range from roughly 1 per 500bp to roughly 1 per 10 million...recipient plasmid to insert ratio of approximately 1:3. Since the number of base pairs for each varies,...cells. For most standard cloning, you can transform 1-2μl of your ligation reaction into competent cells...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...
  18. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...characterized by a cloudy haze in the media (Figure 1). Notes: Some protocols require bacteria to be in ...following the Isolating Your Plasmid DNA protocol. Figure 1: Media without growth (top) and with growth (bottom...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...solution of your antibiotic. Unless otherwise indicated, the antibiotic powder can be dissolved in dH ...
  19. Pipetting Protocol

    Type
    Protocol
    ...dispense small amounts of liquid (think: 0.1 µL to 1 mL). When working in a laboratory, properly dispensing...right. Pipette Dispense Volume P2 0.2 to 2 µL P10 1 to 10 µL P20 2 to 20 µL P100 10 to 100 µL P200 20 ...and the third (red) digit is hundredths. Therefore, 1 µL would read as 100 (as shown in the picture above...dispensed. The boxes that the tips come in often indicate a volume range that the tip can hold. This should...no liquid should drip from the tip. This could indicate that the tip is not on the pipette properly. Place...pipette tip by holding the pipette tip over your dedicated waste container and pressing on the tip ejector...
  20. Protocol - How to Streak a Plate

    Type
    Protocol
    ... as shown in the diagram above, to create streak #1. Pro-Tips Hold your tooth pick at an angle, the way... or freshly sterilized loop, drag through streak #1 and spread the bacteria over a second section of the...plate to inoculate a bacterial culture for DNA purification will minimize the chance of having a mixture...
Showing: 721 - 740 of 747 results