... large inserts AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid 911E4 ... This construct is then transformed into AdEasier-1 cells , which are BJ5183 E. coli cells containing ...multiple viruses. The adenoviral backbone pAdEasy-1 is suitable for most purposes. For especially long...Glossary Packaging Vocabulary Term Definition pAdEasy-1 Adenovirus packaging plasmid that lacks E1 and E3 ... for viral transcription; Supplied by the pAdEasy-1 packaging plasmid or 911E4 packaging cell line Transfer...adenoviruses replication deficient? Typically yes, because the early genes necessary for replication have been...events creating replication-competent virus increases with each round of amplification. What is RCA? RCA...

... based on the HIV-1 virus. For safety reasons, transfer plasmids are all replication incompetent and may...shRNA‐expressing lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps...Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed . Altering the tropism of lentiviral vectors...Curr Gene Ther. 2005. 5(4): 387-398. PubMed . HIV-1 Genome Nuclear Import Is Mediated by a Central DNA...Interchangeable: usually encodes for VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding...encoding various HIV genes. Safer. Replication incompetent and always SIN: Uses 4 plasmids instead of 3 and...

...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...

...immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...

.... Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific cation influx into the cell...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...

...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack... in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80. PMID: 25357182...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...

...the full-length transgene at very low efficiency (<1% of wild type). If either of these methods can be ...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...therapeutic applications. Clinical trials using AAV for various gene delivery applications are currently...adenovirus. These genes (E4, E2a and VA) mediate AAV replication. The transfer plasmid, Rep/Cap, and the helper...integrations may occur at a much lower frequency. As a replication-incompetent virus, AAV cannot enter the lytic...double stranded synthesis. These episomes can concatemerize, producing high molecular weight structures ... are thought to be maintained in episomes or concatemers. Episomes differ profoundly from viral particles...

...supE44 thi-1 gyrA96 relA1 tonA JM109 Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- ...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria... Educational Resources Molecular Biology Reference Molecular...plasmid selection DNA sequencing for plasmid verification Resources Genetic Code Webpage and Blog References...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...

...out our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic ligand. The chemogenetic...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534... KM, Brown KM, Forbes SL, Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer...

...Strong mammalian promoter from human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter...polymerase. DNA sequences called response elements are located within promoter regions, and they provide a stable...cells. Core Promoter The core promoter region is located most proximal to the start codon and contains the...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions...eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...