We narrowed to 15 results for: cat.1

...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5...

...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT... GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...protein purification tags and fluorescence proteins for use in E. coli for a variety of applications. EcoFlex...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning... between. MoClo can be used for a variety of applications—like building synthetic genetic circuits, engineering...

...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...

.... Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific cation influx into the cell...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate... Educational Resources Molecular Biology Reference Promoters...BioRender.com. DNA sequences called response elements are located within promoter regions, and they provide a stable...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions... (TSS) (Figure 2). The Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...

... serve as origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome...tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating different serotype(s...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...potential formation of replication-competent viruses. While AAV themselves are replication incompetent, there...production of replication-competent viruses that would be able to infect cells and replicate autonomously...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria... not located elsewhere in the plasmid backbone. In expression plasmids, the MCS is often located downstream...advantage of the process of DNA replication in vitro. During replication, the DNA helix is unwound by a...

...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ... gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...

...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ... Pooled Library Amplification Protocol for Addgene's generalized library amplification protocol. Read ...: Pooled Library Guide Introduction Library Amplification Types of Screens Resources Pooled libraries ..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...

...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest... Educational Resources Molecular Biology Reference Molecular...interest and then insert them into plasmids for replication and protein expression. There are many methods...restriction sites to any piece of DNA during PCR amplification, allowing for it to then be digested and ligated...cut your insert or backbone at only the desired location for your cloning project. Restriction enzyme cloning...transformed directly into E. coli , where the normal replication process will repair the nicks. It is important...