...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...protease inhibitor cocktail. Add 1 part Protein A/G binding buffer to 1 part tissue culture supernatant...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...°C bead bath Clamp stand and clamps Autoclave 0.1–1 mL single channel pipette 0.5–10 µL single channel...

...Vented Falcon Tubes at 30-37 ℃, 225 rpm for 1 hour. After the 1 hour shaking period, pool and gently mix ...pulse and follow all specifications described in the equipment manual. Immediately add 1 mL SOC to cuvette...Last Update: August 17, 2023 Workflow Timeline Day 1: Transform, recover, set up overnight growth (Estimated... (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other ultra-high...0.1 cm ) 20 mL SOC recovery media (Lucigen, 80026-1) 8X LB Agar + Antibiotic 245 mm bioassay plates (Molecular...into each of four 14 mL Vented Falcon Tubes and have 1 mL SOC per electroporation readily available for post-electroporation...autoclaved, sterile reagents for all steps. Procedure Day 1 Add 200 ng DNA to each 50 µL aliquot of thawed Endura...

...Preparation 1 M NaCl/PBS-MK buffer Dissolve 5.84 g of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS ...iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and...cartoon indicating the position of the needle for harvesting of the purified AAV using option #1. Right...Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing... step: mix 4.5 mL of 60% iodixanol and 13.5 mL of 1 M NaCl/PBS-MK buffer 25% iodixanol step: mix 5 mL ...Hamilton needle, taking care to avoid bubbles (Figure 1). 8 mL of 15% iodixanol step 5 mL of 25% iodixanol...disturb the gradient!** Collect Fractions Option #1 Prepare a row of roughly 20 open 1.5 mL microcentrifuge...

...annealing can be achieved by one of two methods: Method #1 Place the mixed oligos in a 1.5mL microfuge tube. ...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...

...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...

...DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...: Monday: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Wednesday: Plate 1×10 6 cells in a...Workflow Timeline Day 0: Seed 293T packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection...inactivated in the lab by heating to 56°C for 30 min. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) ...to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations Before...enough PEI such that the ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid...

...tissues: use 1 mL of Solution D per 100 mg of cells. For cultured cells: use 1 mL of Solution D per 1 X 10 7...tissues: use 1 mL of TRIzol® per 100 mg of cells. For cultured cells: use 1 mL of TRIzol® per 1 X 10 7 cells... to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL water-saturated...Option A): Add 1 volume of Isopropanol to the extracted aqueous layer. Incubate at -20°C for 1 hour. Lithium.... Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used. Shake vigorously by hand for...or downstream applications. To improve yield of RNA, instead of incubating at -20°C for 1 hour, you can...

...Dilution 1:10 100 of Stock Virus 900 150 1,350 1:100 1:100 100 of 1:10 900 150 1,350 1:1,000 1:1,000 100...100 of 1:100 900 150 1,350 1:10,000 1:10,000 100 of 1:1,000 900 150 1,350 1:100,000 1:100,000 100 of 1... 1:10,000 900 150 1,350 1:1,000,000 Mix the dilutions well Note: the 1:10 dilution can usually be omitted...with 1 mL of 0.1% crystal violet for 10 min at RT. Gently remove the stain. Wash cells 3x with 1 mL of...dilutions. Sample Data Figure 1: A549 cells were transduced with the indicated serial dilutions of the lentiviral... media from the wells. Gently wash the cells with 1 mL of PBS and aspirate wash. Filter 0.1% crystal violet...volume in the well (mL) x dilution factor e.g., If the 1:100,000 well has 75 colonies, then there are 75 colonies...

...dilution Dilution 1 (DNase step) 5 uL AAV stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution...range from 1 x 10 12 GC/mL to >2 x 10 13 GC/mL and we use an internal reference virus that is 1 x 10 13 ...dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock made in step #1): Volume of 2 ...Data Figure 1: Example of a valid 8-point standard curve. Figure 2: Example of the amplification plots obtained...Equipment qPCR instrument Heating plate Pipettors 1–10 µL single channel pipette 20–200 µL single channel...channel pipette 200–1000 µL single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette...The reference material should have a titer within 1-log of the expected titer of the samples being tested...

...Volume of 1 mg/mL PEI (μL) 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9...were transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high.... Thawed aliquots should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da ...stable. Dilute 1:3 (µg DNA:µg PEI) in 500 µL total of OptiPro SFM (per 10 cm plate). 56.7 µL of 1 mg/mL PEI...subclone of HEK293T optimized for viral production) Day 1: Transfect Cells Day 2 (am): 18 h post transfection...to be empirically determined for each new batch of 1 mg/mL PEI prepared. There may be variation between...plasmid using a variety of ratios. Check the cells 1–2 days after transfection to determine what ratio ...

...Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400)...95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold 4 ...Use a single channel 1–10 µL pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution... 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer (1:160,000) Dilution 5 (20X...95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in 50 µL 1X PCR buffer (1:6,400,000) Dilution ...50 µL 1X PCR buffer (1:12,800,000) Dilution 8 (2X): 50 µL in 50 µL 1X PCR buffer (1:25,600,000) Use multichannel...pipettes for the dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For...

...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ...Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with 2 mg total DNA per CS5 Plasmid ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine ...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice between...C before proceeding with the purification protocol. Sample Data Figure 1: HEK293T cells at various confluencies...

...from 1:1 to 1:6. Add the diluted PEI-MAX to the diluted DNA. Cap the tube and vortex with three 1 s pulses...solution at -20 °C. 1 mg/mL PEI-MAX Add 1 g of PEI-MAX powder to 900 mL deionized water in a 1 L bottle and ...to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second tube of 6 mL BCD TFX (for a 1 mg/mL stock solution ...Last Update: February 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells... a time. Add deionized water to a final volume of 1 L and recheck pH to ensure that it has not drifted...Aliquot and freeze upright at -20 °C. Procedure Section 1: Seeding cells The day prior to transfecting, seed...of two 50 mL tubes. Cap the tubes and incubate for 1 h in the 37 °C bead bath. Transfer the PEI-MAX and...

...both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs working...(PPE) for BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs...Labs Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more ...BSL-2 includes all of the precautions needed in BSL-1, however there are additional precautions that lie...always wear glasses/goggles in addition to the BSL-1 requirements. Conclusion Although simple, following...choose to reuse or repurpose this SOP in another location, please note that you do so at your own risk; ...

...polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:50 30 1468.5 1.5 1:75 20 1478.5 1.5 1:100 15 1483.5...the dilution factors (method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over ...regulations. Workflow Timeline Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace...for 48–72 h. Gently aspirate media and replace with 1 mL of PBS. Calculate the fraction of fluorescent-positive... example: If 150,000 cells were transduced in the 1:100 well, resulting in 25% fluorescent cells, then...average of multiple dilutions. Sample Data Figure 1: 293T cells were transduced with a range of dilutions... these cells can still be used in downstream applications. Safety Warnings Lentivirus is generally considered...

...95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold 4 ... primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 .... Last Update: July 7, 2023 Workflow Timeline Day 1: Seed and transduce cells Day 4: Treat cells with ...Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1–10 µL single channel pipette 20–200 µL single channel...TrypLE, Thermo Fisher, 12605010) Ethanol, VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10... each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well...

...June 14, 2023 Workflow Timeline Day 1: Run SDS-PAGE and stain gel Day 1 or later: Image analysis Video Watch...lane Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 ...mobility of the bands (sample AR0016 in Figure 1) indicates that the samples may not have been processed...antibodies using Coomassie stain. Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel...deionized water. Gently invert to mix. Procedure Section 1: SDS-PAGE Add 5 µL of 4X sample buffer to each sample...attach to a power supply. Run the gel at 150 V for 1 h . Pro-Tip If the samples are running unevenly and...Add 20 mL of SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour...

... provides information for both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of...guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...Safety for Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols...each level has different safety requirements. BSL-1 is designated for those working with microbes that...BSL-2 includes all of the precautions needed in BSL-1, along with additional precautions to prevent injuries...container Fire blanket Fire extinguisher Guidelines BSL-1 Guidelines Before You Work Right after entering the...hygiene officer. BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed...

...DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase... treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing...collection of empty LIC cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often...reaction for 5 minutes at room temperature, then add 1 μl of 25 mM EDTA, followed by another 5 minutes at...The reaction is now ready for transformation. Use 1-2 μl of annealing reaction for each transformation... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...

...restriction digestion reaction could look like this: 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer...definition: one unit of enzyme will cut 1 µg of DNA in a 50 µL reaction in 1 hour. Using this ratio, you can .... For diagnostic digests, 1-2 hours is often sufficient. For digests with >1 µg of DNA used for cloning...requires 1 µg of DNA. The total reaction volume usually varies from 10-50 µL depending on application and ... for 1 hour. Always follow the manufacturer’s instructions. Pro-Tip Depending on the application and the...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...