Skip to main content
Addgene

We narrowed to 395 results for: POR C

Showing: 91 - 120 of 395 results
  1. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ... Boeckman, J. X., Manning, C. F., Nguyen, J. T., Bechtold, H., Dumitras, C., Gong, B., Nguyen, K., Van...-GABA-AR β1 (white) and anti-GABA-AR β3 (green). (C) Hippocampus labeled with anti-Kv2.1 (magenta), anti-AnkyrinG... Panels C1-C3 show magnified detail of the box in C. Image adapted from Andrews et al., 2019 under CC-... J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C. J., Gola, A., Thakur, N., Shih, R., Yao, L., Yaniv...protocol is a good place to get started.  One important consideration when deciding whether you can do...specific considerations to keep in mind. Most importantly, make sure you are using primary antibodies from...
  2. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    ...4355596 King, S. R., Duggal, N. K., Ndongmo, C. B., Pacut, C., & Telesnitsky, A. (2008). Pseudodiploid Genome...A., Hunter, E., & Kappes, J. C. (1997). Functional RT and IN incorporated into HIV-1 particles independently...34372494. Prussin, A. J., Garcia, E. B., & Marr, L. C. (2015). Total Virus and Bacteria Concentrations in...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Multi-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK...pathway in vivo . DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Taipale 87065 pcDNA3.1-ccdB-Renilla Renilla Creation of C-terminal Renilla luciferase fusions using Gateway ...Taipale 87066 pcDNA3.1-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ... 87074 pLenti6.2-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ...
  4. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ... Sellnow, R. C., Boye, S. L., Coberly, B., Bennett, A., Agbandje-McKenna, M., Sortwell, C. E., Hauswirth...Backer, M. W. A., Brans, M. A. D., Luijendijk, M. C., Garner, K. M., & Adan, R. A. H. (2010). Optimization...Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette, J. E., & Vandenberghe..., J. Y., Han, J. H., Lee, H., Han, Y. E., Rah, J. C., & Park, H. (2020). Labeling dual presynaptic inputs...injection site  (Kanaan et al., 2017), axonal transport  (Murlidharan et al., 2014), and postsynaptic ... system, remember that some serotypes can be transported retrogradely and/or anterogradely along the axon...et al., 2014; Nieuwenhuis et al., 2021). It is important to note that this expression pattern can be affected...
  5. Antibodies 101: Normalization and Loading Controls for Western Blots

    Type
    Blog Post
    ...independent blots. B–C) Graphs showing the relative intensity of the β-actin (B) or total protein (C) on the membrane...quantification in panel B is not especially linear. In panel C, two different methods of quantifying total protein...linear. Note the different y-axes between panels B and C, indicating that β-actin is less sensitive as well...BioRender.com. Loading controls are even more important for semi-quantitative western blots. No pipetter...in the same lane, and the resulting fraction is reported. Figure 2: Normalization with loading controls...equally strong, so the normalized value simply reports which POI band is stronger. The right gel has exactly...abundance on your membrane, which would be directly reported by band intensity. Researchers use later steps...
  6. Validated gRNA Sequences

    Type
    Collection
    ...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...
  7. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ... was reduced by growing seed stocks at 30°C compared to 42°C. Screen multiple colonies to isolate the ...19763938. Maucksch C, Bohla A, Hoffmann F, Schleef M, Aneja MK, Elfinger M, Hartl D, Rudolph C. Transgene expression...Growing the culture at a lower temperature such as 30°C or optimizing the incubation time can help maintain...long-read sequencing techniques, such as Oxford Nanopore sequencing or PacBio SMRT sequencing, (which differ...long-read sequencing (1-25 kb), such as Oxford Nanopore sequencing or PacBio SMRT sequencing. These longer... plasmid multimerization troubleshooting tips. Portions of this figure were made with BioRender. ...AE. Generic plasmid DNA production platform incorporating low metabolic burden seed-stock and fed-batch...
  8. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular...identification of FLPe which has a temperature optimum of 37 °C (Buchholz, Angrand, and Stewart 1998). FLPe’s performance... receptor (ER) ligand binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These...FLP-FRT. In addition, a variety of means to spatiotemporally control FLP and Cre expression have been developed...These differences in recombinase efficiency are important to keep in mind when deciding whether to use the... only occur at a specific time point? To allow temporal control, ligand regulated Cre and FLPe recombinase...control of Cre recombinase. After in-utero electroporation, this plasmid mix results in sparse labeling...
  9. pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs

    Type
    Blog Post
    ...the reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade hiPSCs...vectors that encoded six factors - OCT3/4, SOX2, KLF4, C-MYC, LIN28 and SV40 large T antigen (SV40LT). The ...of TP53 enhances iPSC generation as does replacing C-MYC with L-MYC [10, 11]. While the mechanisms underlying...understood, the addition of an shRNA for P53 and replacing C-MYC with L-MYC in the episomal reprogramming cocktail...into cells by electroporation. hiPSC colonies are obtained by 10 days after electroporation, most of which...over a decade back when Yamanaka and colleagues reported that it is possible to reprogram differentiated...generation of human iPSCs (hiPSCs) now provides an opportunity to develop and use patient-specific somatic cells...
  10. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ...21356876. 5. J. Chow, Z. Marka, I. Bartos, S. Marka, J. C. Kagan, Environmental Stress Causes Lethal Neuro-Trauma...PubMed PMID: 28704652. 6. V. Rodríguez, D. Didiano, C. Desplan, Power tools for gene expression and clonal...Neurosci. 9, 703–709 (2006). PubMed PMID: 16582903. 8. C. J. Potter, B. Tasic, E. V Russler, L. Liang, L. Luo...you to systematically study gene function with temporal control and cell-type specificity! The Gal4/...
  11. Antibodies 101: Flow Cytometry Controls

    Type
    Blog Post
    ...starting point for compensation (Fig. 1B-C). However, it’s important to note that because you’re using beads... single color control for the APC channel. B) and C) A flow plot showing an APC single color control prior...prior to compensation (B) and after compensation (C) with APC-Cy7.   FMOs FMO stands for fluorescence...
  12. 7 Tips to Secure a STEAM Internship This Summer

    Type
    Blog Post
    ...and Rose C. St Pierre, founders of STEAMid. Internships open doors to a web of opportunities that the ...guest bloggers Roodolph (Roo) P. St Pierre and Rose C. St Pierre! Roodolph (Roo) P. St Pierre is currently...populations. Roo is the co-founder of STEAMid.       Rose C. St Pierre is currently a graduate student at Northeastern... not deter any student from applying to the opportunities of their dream.  To help students focus on the...below:  1. Eligibility check Scrutinize every opportunity prior to starting an application to assess your...unless you are applying for a Federal Government opportunity, which tends to be more detailed. Beyond the ...draft a personal statement, which is the perfect opportunity to paint a comprehensive picture of your academic...
  13. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ...to fuse the activators instead of at the protein’s C terminus. With that new design in place, Konermann...Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...nucleolytically inactive Cas9-VP64 fusion; 2. A sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop...knockout screening). As the Zhang lab's Nature paper reports, “Here we have shown that the SAM system is robust...size of the backbone, transformations require electroporation. References & Further Reading: For more ...
  14. CRISPR 101: Non-Homologous End Joining

    Type
    Blog Post
    ...Oh S, Tomkinson AE, Hendrickson EA, Giovannangeli C, Jasin M, Brunet E (2014) Chromosomal Translocations.../10.1016/j.molcel.2014.08.002 Ran FA, Hsu PD, Lin C-Y, Gootenberg JS, Konermann S, Trevino AE, Scott DA... Yan M-Y, Li S-S, Ding X-Y, Guo X-P, Jin Q, Sun Y-C (2020) A CRISPR-Assisted Nonhomologous End-Joining...process involve repairing chromosomal DSBs. It is important to know that cells possess two major repair pathways...chance of causing a frameshift mutation. Of some importance, the deletion can be less heterogeneous when ...
  15. Deep Dive: qPCR

    Type
    Blog Post
    ...Annealing temperature should be 60-65°C For qPCR, the important primer variable is the annealing temperature... the primers.  Melting temperature should be ~60°C (between 50 and 65, with no more than 3 degrees between...curve will show multiple peaks.    (a) (b)  (c)   Fig. 1: Melt curves showsing (a) a single peak...dimers. (b) A shoulder peak indicating primer dimers. (c) A double peak indicating 2 amplicons. Image credits...02217-xTaylor, SC; Nadeau, K; Abbasi, M; Lachance, C; Nguyen, M; Fenrich, J. The Ultimate qPCR Experiment...Zuo J, Dong X, Zhang M, Hu G, Fang F. Fudenine, a C-terminal truncated rat homologue of mouse prominin...step. Scorpion chemistry in particular has been reported to work well in the Lightcycler while being relatively...
  16. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ...mDia1 and CP appearance at the filament tip from (a). c) Intensity traces at the tip of the filament from ...10.1021/cb900062k Gautier, A., Juillerat, A., Heinis, C., Corrêa, I. R., Kindermann, M., Beaufils, F., & Johnsson...https://doi.org/10.1126/science.281.5374.269 Jing, C., & Cornish, V. W. (2011). Chemical Tags for Labeling... M. G., Hartzell, D. D., Karassina, N., Zimprich, C., Wood, M. G., Learish, R., Ohana, R. F., Urh, M.,...doi.org/10.1038/nmeth749 Strebinger, D., Frangieh, C. J., Friedrich, M. J., Faure, G., Macrae, R. K., &...amino acids to directly incorporate a fluorophore in your protein or to incorporate an alkene to be labeled... self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from Roger Tsien’s lab ...
  17. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ...interactions New auxin inducible degron system for C. elegans New CRISPR plasmids New items from the viral...tool-kit for the auxin inducible degron (AID) system in C. elegans By Alyssa Cecchetelli The auxin inducible... degron (AID) system has been extensively used in C. elegans since 2015 to conditionally degrade proteins...length can and should be varied as it can have important implications for the fusion protein effectivity...upon these original tools that allows for both spatiotemporal protein degradation and quantification of this...et al., 2021.   The AID system relies on a transport inhibitor response 1 (TIR1) expressed under a ...a desired promoter with a specific spatiotemporal expression pattern and an auxin inducible degron (AID...
  18. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...at 95 °C, a common lysis temperature, so consider a longer incubation (10–20 minutes) at 70 °C, or a truly... Additionally, protein lysis should be done at 4 °C or on ice, whichever is more practical. If your lysing... truly lengthy incubation (30–60 minutes) at 37 °C, if you suspect aggregation in your prep. If your proteins...protein-based blockers degrade fairly quickly, even at 4 °C, so when in doubt, make up a fresh batch.  Antibodies...and time. Though the most common conditions are 4 °C overnight or room temperature for 1–2 hours, there...sample loaded Incubate primary antibody at 4 °C overnight Incomplete washing Ensuring wash is...under-transferring.  Membrane pore size Membranes come in different pore sizes for different proteins:...
  19. TALEN Plasmids and Kits

    Type
    Collection
    ...containing unique shorter N- and C-terminal domains (N153AA, C47AA). The reporter vector pGL4-SSA can be used...GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation at rates much higher...pCS2 expression vector resulting in shorter N- and C-terminal tal protein segments (136AA and 63AA, respectfully...promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which were initially...wild-type TAL amino acids after the repeat domain, and C-terminal SV40 NLS and HA tags. Plasmid 47389 also ... of the minimal activation domain of VP16) at the C terminus. 47389 pcDNA3.1-GoldenGate-VP64 Golden Gate...expression, and encode one of three 0.5 TALE repeats (C, T, and G) and the full length human LSD1 at the carboxy-terminus...
  20. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...conformations: (A) bent-closed, (B) extended-closed, and (C) extended-open. When a ligand binds, it typically ... with much lower affinity than their open states (C). Figure courtesy of IPI. IPI anti-integrin toolset...and resources References Hao, Y., Yan, J., Fraser, C., Jiang, A., Anuganti, M., Zhang, R., Lloyd, K., Jardine...Jaumouillé, V., Hao, Y., Coppola, J., Yan, J., Waterman, C. M., Springer, T. A., & Ha, T. (2022). Single-molecule...in competition with other similar integrins, as reported by IPI and the Springer lab (Hao et al., 2024)...In this study, we, along with the Springer lab, reported the binding specificity, kinetics, and affinity...belief that αVβ3 would be the most functionally important integrin on these cells. What’s next IPI is working...
  21. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    .../000504294 Wang, T., Guan, C., Guo, J., Liu, B., Wu, Y., Xie, Z., Zhang, C., & Xing, X.-H. (2018). Pooled...doi.org/10.13918/j.issn.2095-8137.2016.4.237 McCusker, C., & Gardiner, D. M. (2011). The Axolotl Model for ...elife.50651 Vieira, W. A., Wells, K. M., & McCusker, C. D. (2019). Advancements to the Axolotl Model for ... areas of microbial research like metabolism. Transport, biofilms, and much more. Because of it’s BSL-...designed for use in Arabidopsis. There are also important tips for plant transformations and the use of ...
  22. RNA Extraction Without A Kit

    Type
    Blog Post
    ...store them in a -80°C freezer to prevent RNA degradation. They will degrade in a -20°C freezer.   RNA extraction...DEPC. Alternatively, glassware can be baked at 180°C for at least 4 hours.   If your final RNA sample(s...extractions- if you need really clean RNA, it’s important to make sure that when extracting, to only take...
  23. Plasmids 101: Golden Gate Cloning

    Type
    Blog Post
    ...cloning method with high throughput capability. Engler C, Kandzia R, Marillonnet S. PLoS One 2008;3(11):e3647..., Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic...2011 Apr 14. PubMed.   Golden Gate cloning. Engler C, Marillonnet S. Methods Mol Biol. 2014;1116:119-31...like Gateway cloning or Gibson assembly. Another important consideration is the design of flanking overhangs...
  24. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...fragments: N-terminal BirA* (N-BirA*) and C-terminal BiraA* (C-BirA*). These two fragments are fused to...also which fragment of BirA*, either the N- or the C-terminus, the bait proteins were tagged with. It’s...interacting proteins. No spatiotemporal control. Many PPI detection methods lack spatiotemporal control or an “... lysate fractionation. Important considerations for Split-BioID It’s important to remember that with Split-BioID...this limitation by creating Split-BioID, a spatiotemporally controllable version of the proximity-dependent...The Split-BioID method Enter Split-BioID, a spatiotemporally controllable version of the BioID protocol... other PPI methods, including BioID, is its spatiotemporal controlled labeling of interacting proteins...
  25. Technical Design of a Western Blot

    Type
    Blog Post
    ...length of your assay. The most common options are 4 °C overnight or 1–2 hours at room temperature (RT). Most...to incubate their primary antibody overnight at 4 °C and their secondary antibody for 1–2 hrs at room temperature...the DIY method. As some proteins aggregate at 95 °C, you may want to check for any available data on the...expensive, reduce protocol time, can be stored at 4 °C, and are very consistent gel-to-gel.  Ladder Whatever...stored at your bench during the procedure and at 4 °C when you’re not running a western. They are not very...will noticeably degrade after several months at 4 °C.  Pro tip! If you get a speckled image, your protein-based...variety of pore sizes. If your protein of interest is small, you may want to consider a smaller pore size (...
  26. CRISPR Plasmids - Tagging

    Type
    Collection
    ... N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous...CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous proteins. The PITCh system ...CRISPR targeting vectors to insert genetic tags in the C. elegans genome. The SapTrap reaction produces a single...genome modification. This system can be used to create C- and N-terminal epitope tags. The plasmids in the ...terminal tagging in Drosophila cells 3.3 MB Seydoux C. elegans Tagging System Geraldine Seydoux's lab has developed...
  27. Educational Planarian Tools for Teaching Developmental Biology Techniques

    Type
    Blog Post
    ...Williams, Eric J. Ross, Sofia M. C. Robb, Sarah A. Elliott, Kimberly C. Tu, Alejandro Sánchez Alvarado,...discovered and characterized in an unrelated worm (C. elegans) [2]. Delivering dsRNA matching a specific...Hybridization (WISH) WISH is a technique that detects the temporal and spatial localization of mRNA transcripts in...
  28. CRISPR 101: Targeting Non-Coding RNAs with CRISPR/Cas9

    Type
    Blog Post
    ...still unexpectedly affect nearby genes (Figure 1A-C). Find CRISPR plasmids at Addgene! Knock-in: Introducing...site (TSS) deletion. (B) Mutations of splice sites. (C) Removal of an exon or a large genomic fragment. (... doi:10.1080/15476286.2014.996067 Basak J, Nithin C. Targeting Non-Coding RNAs in Plants with the CRISPR-Cas...experiments are important for visualizing ncRNA localization and function, but directly incorporating very long...transcribed but do not encode proteins. They play important roles in many cellular and regulatory processes...complex and not yet fully understood, so it is important to carefully select the target locations of knock-in...nuclease-dead Cas9 protein (dCas9) and a sgRNA to temporarily block the transcription machinery of a target...
  29. Viral Vectors 101: Voltage Indicators

    Type
    Blog Post
    ...   References and Resources   References Beck C, Zhang D, Gong Y. Enhanced genetically encoded voltage...: 10.1016/j.cobme.2019.10.010. Bando, Y., Grimm, C., Cornejo, V.H. et al. Genetic voltage indicators.... 71 (2019). doi:10.1186/s12915-019-0682-0. Beck, C., Gong, Y. A high-speed, bright, red fluorescent voltage...sensors are better classified by their fluorescent reporter and the mechanism of their voltage sensing component...rhodopsin proteins were initially evolved for ion transport, not fluorescence, they are not nearly as bright...for penetrating deeper tissues depths (1 mm), important for certain applications such as in vivo tissue...rhodopsin Ace2N and mScarlet. Ace2N quenches a proportion of mScarlet's emission via FRET.  Image from ...
Showing: 91 - 120 of 395 results