Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 89 results for: 5-Oct

Showing: 61 - 80 of 89 results

  1. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...Temporarily inhibiting this complex may allow time for 5′ flap exonucleases and DNA ligases to act first. PE4... optimized enzyme can be used with any of the PE2-5 approaches, sometimes referred to as PE2max, PE3max...with twin prime editing. Nature Biotechnology, 40(5), 731–740. https://doi.org/10.1038/s41587-021-01133...post was originally written by Jennifer Tsang in October 2019 and updated by Emily P. Bentley in December...

  2. Uncertainty about Labor Law Brings More Uncertainty to Postdoc Wages

    Type
    Blog Post
    ...whose plans are unknown (up to 33% from 22%), a full 5% of postdocs who were expecting a salary increase ...of Information Act (FOIA) requests for their postdoctoral salary information as of December 1st. Salary...are an important step forward in helping the postdoctoral population continue to pursue academic work,...of the scientific enterprise by reducing the postdoctoral population which keeps growing despite a lack...

  3. Genetic Code Expansion

    Type
    Collection
    ...174719 pRSF-G1pCNPRS G1pCNPRS M. archaeon L-3-(2-cyano-5-pyridyl)alanine (pCNP) Bacterial TAG Thomas Huber ...Methanogenic archaeon 4-Fluoro-L-Tryptophan (4FTrp), 5-Fluoro-L-Tryptophan (5FTrp) Bacterial TAG Thomas Huber...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang...

  5. Changing Labor Laws Bring Increased Postdoc Wages

    Type
    Blog Post
    ...implies. These 5 organizations, according to the NSF data, account for 18% of the postdoctoral workforce in...exactly how postdoctoral salaries are changing. Transparent salary information for postdoctoral positions...institutions set their postdoctoral salary scales to the NRSA scale (Figure 21, National Postdoctoral Association...Stanford raised salary levels to $50,000, and as of October 1st the salary minimum was raised again to $51,...as having postdocs, representing ~85% of the postdoctoral workforce. Based on our communications with ...to have to get rid of postdocs; that current postdoctoral appointments may shorten in length; that postdoc...approach to biomedical research in the U.S. and postdoctoral training has not been demonstrated to be required...

  6. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...industry postdoc  Time: Academic postdocs can be long—5 years or more, especially in the biological sciences—whereas... post was contributed by Laura Desrochers, a postdoctoral scientist at AstraZeneca. Why I chose an industry...Desrochers! Laura Desrochers is currently a Postdoctoral Scientist at AstraZeneca. She has a background...blog posts here Find 9 tips for a successful postdoctoral experience Read Joanne Kamen's 8 tactics for...

  7. Management for Scientists: Delegating is Key

    Type
    Blog Post
    ...This is the fourth in a 5 part series on Management for scientists. Once you are responsible for managing...delegation tips and practices can be found at the Time Doctor Blog "The Art of Delegation: Developing This Essential...

  8. Thoughts on the Future of Research 2015 Boston Symposium

    Type
    Blog Post
    ...the life sciences end up in tenure track position 5 years after receiving their PhDs, still strive to ...research community to develop a plan to make postdoctoral pay/benefits commensurate with work training...a postdoc as “An individual who has received a doctoral degree (or equivalent) and is engaged in a temporary...image below). Slide of information gathered by Postdoctoral Associations around Boston - From Panel Session... staff scientists. This results in a glut of postdoctoral trainees who, even though they are aware that...become actionable. Additional Resources The Postdoctoral Experience Revisited. PubMed PMID: 25590106....

  9. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ... plasmids bearing one of the distal-less homeobox 5 and 6 (Dlx5/6) enhancer elements and combined it with... and constitutively expressed sgRNA targeting the 5’ end of each essential gene. Koo M, et al. Cell Systems... through the expression of transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model...Addgene and include a variety of cMYC, KLF4, SOX2 and OCT4 DNA binding domain and transcription activation ...

  10. 7 Tips to Secure a STEAM Internship This Summer

    Type
    Blog Post
    ...will end up with a stellar letter of support.        5. Application submission  Set a calendar reminder for...Pierre! Roodolph (Roo) P. St Pierre is currently a doctoral candidate in the Chemical Biology Program at Harvard...

  11. Validated gRNA Sequences

    Type
    Collection
    ... must be used with targets that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....

  12. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    ...Applications in Gene Therapy: An Overview.” Cells, 12(5), 785 (2023). PubMed PMID: 36899921. Resources on...Guerin and Susanna Stroik. Didem Goz Ayturk is a Postdoctoral Fellow in Connie Cepko’s Lab investigating neuronal...

  13. Plasmids 101: The Wide World of Natural Plasmids

    Type
    Blog Post
    ...numerous genetic elements in the human gut. Cell, 187(5), 1206-1222.e16. https://doi.org/10.1016/j.cell.2024.01.039...January 2017 and was updated by Emily P. Bentley in October 2024. References and Resources References Demanèche...

  14. Tips for Technical Support Calls

    Type
    Blog Post
    ...number of messages in our thread or remove a good 5 minutes from our phone call. If your concern is ...searches scientific articles, patents, and even some doctoral dissertations. Streamline the question asking...

  16. Adapting Toehold Switches to Detect Zika Virus

    Type
    Blog Post
    ... environmental suitability for Zika virus." Elife 5 (2016): e15272. PubMed PMID: 27090089. Resources on... switches for pathogen detection In 2014, as postdoctoral fellows with Jim Collins and Peng Yin at the...

  18. Production of Virus in Insect Versus Mammalian Cells

    Type
    Blog Post
    ... Cells HEK-293T Sf9 Time to collection 2–4 days 5–10 days Purification Ultracentrifugation (AAV); ...the insectspodoptera frugiperda (lepidoptera; noctuidae). In Vitro, 13(4), 213–217. https://doi.org/10.1007...

  20. Transferable Skills Guide: Career Planning Resources

    Type
    Blog Post
    ...surprising-rules-you-should-know-regarding-linkedin-etiquette/5/#4050d70b1e9c https://www.linkedin.com/pulse/20140417174121... students today is that many graduate and post-doctoral programs lack any formal or mandatory professional...
Showing: 61 - 80 of 89 results