We narrowed to 5 results for: 5-Oct

...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse L4440 AGCGAGTCAGTGAGCGAG 5' of MCS in L4440 vector Forward...LacI-R GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA... pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...GTTGCCTTTACTTCTAGGCCT 5' of EcoRI site in pcDL vector Forward pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in ...

...one isothermal reaction. First, the 5’ exonuclease chews back the 5’ ends of your DNA fragments, generating...dsDNA of interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no...specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This fragment can...properties of three common molecular biology enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly...DNA polymerase then closes the gap created by the 5’ exonuclease. Finally, ligase seals the nicks in the...has the potential to be completely degraded by the 5' exonuclease. Read more in our Gibson Assembly blog...more in our Golden Gate Cloning blog post . Figure 5: Summary of Golden Gate cloning. Created with BioRender.com...

...pairs long and are adjacent and typically upstream (5’) of the sense or coding strand of the transcribed...two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions from the transcription... Plasmids 101 topics Content last reviewed: 22 October 2025...

...supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC...specialized membranes containing nanopores (Figure 5). A motor protein then unwinds double-stranded DNA... plasmid sequences can be read in one run. Figure 5: Summary of long-read Nanopore sequencing. Created...blog Addgene Protocols Content last reviewed: 22 October 2025...

...inhibition of neuronal activity in vivo. Sci Rep, 5 , 14807. https://doi.org/10.1038/srep14807 PMID: 26443033...Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries K176R mutation. 590 PsChR2...