Skip to main content
Addgene
Showing: 1 - 13 of 13 results

  1. Neurodegeneration Research Collection

    Type
    Collection
    ...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation...and breathing, and often results in death within 3-5 years from symptom onset. Disease mechanisms are still...having no prior family history. A small percentage (5-10%) are familial ALS cases having at least one other...knockout . Maimaitili et al. Nat Commun. 2023 Dec 5. See More Antibodies Find information on Addgene's...

  2. p53 Pathway

    Type
    Collection
    ...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding...Menendez D, Inga A, Resnick MA. Nat Rev Cancer. 2009 Oct;9(10):724-37. PubMed PMID: 19776742 . Germline TP53...3 KAI CD82 molecule Maspin Serpin family B member 5 MDM2 MDM2 proto-oncogene, E3 ubiquitin protein ligase...arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah...Mello SS, Attardi LD. Nat Rev Cancer. 2014 May;14(5):359-70. PubMed PMID: 24739573 . Uncovering the role...

  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...influx/kynurenine efflux cycle. PLoS Biol. 2007 Oct;5(10):e257. Wolf Frommer Return to Top Neurotransmitters...interneurons across vertebrate species. Nat Neurosci. 2016 Oct 31. Gordon Fishell Calcium GCaMP5 genetically encoded...indicator for neural activity imaging. J Neurosci. 2012 Oct 3;32(40):13819-40. Baljit Khakh , Douglas Kim , Loren...marking active neuron populations. Nat Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET... Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic... Encoded Fluorescent Biosensor. Cell Metab. 2011 Oct 5;14(4):545-54. Gary Yellen NADH/NAD+ Peredox fluorescent...

  4. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...amplified with the following primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable...Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186/1475-2859-12-96. PubMed 24161108...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...Jan;33(1):102-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus... Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014....that adding an additional guanine nucleotide to the 5’ of 20-bp guide can increase targeting efficiency....that adding an additional guanine nucleotide to the 5’ of 21-bp guide can increase targeting efficiency....

  6. Plasmids for Stem Cell Research

    Type
    Collection
    ...Developmental Potential of iPSCs. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. Schöler You can also...MicroRNA-Dependent Direct Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral...pluripotent stem cells. Stem Cells. 2009 May . 27(5):1042-9. Townes Lentivirus Human Single polycistronic...fibroblasts by defined factors. Cell. 2007 Nov 30. 131(5):861-72. Yamanaka Plasmid Human Non-integrating transient...integration-free human iPS cells. Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human ...Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii: sctm.2014-0214. Cheng RNA Human Reprogramming...Synthetic Modified mRNA. Cell Stem Cell. 2010 Nov 5;7(5):618-30. Rossi RNA Human Non-integrating, polycistronic...

  7. Tetracycline Inducible Expression

    Type
    Collection
    ...Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546, 548, 550. PubMed . Optimization of the..., Klaver B, Berkhout B, Das AT. Gene Ther . 2006 Oct;13(19):1382-90. PubMed . Improved Tet-responsive ...pCL-CTIG The inducible cassette contains tTA at its 5' end and an inducible promoter at its 3' end, which...

  8. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: 10.1093/dnares/dsx023. PubMed ...6):506-520. doi: 10.1111/gtc.12492. Epub 2017 May 5. PubMed . Allele-specific locus binding and genome...21(4):370-7. doi: 10.1111/gtc.12341. Epub 2016 Feb 5. PubMed . Identification of non-coding RNAs associated...Hoshino A, Fujii H. J. Biosci. Bioeng. 2009 Nov;108(5):446-9. doi: 10.1016/j.jbiosc.2009.05.005. PubMed ...

  9. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...Söll D, Isaacs FJ, Rinehart J. FEBS Lett . 2012. Oct 19;586(20):3716-22. PubMed (Link opens in a new window...iSPI_pSer_Subpool#4 Pooled Library 188530 iSPI_pSer_Subpool#5 Pooled Library 188531 iSPI_pSer_Subpool#6 Pooled Library...Nov;19(11):1371-1375. doi: 10.1038/s41592-022-01638-5. PubMed (Link opens in a new window) rEcoli XpS and...

  10. Immunology Research Plasmids and Resources

    Type
    Collection
    ... HTR3A 5-hydroxytryptamine (serotonin) receptor 3A 5-HT-3, 5-HT3A, 5-HT3R, 5HT3R, HTR3 HTR3B 5-hydroxytryptamine...heavy diversity 5-24 (non-functional) IGHD524 IGHD5-5 immunoglobulin heavy diversity 5-5 DK4, IGHD55 IGHD6...:14099, K5-5, MGC88293 CCR5 chemokine (C-C motif) receptor 5 CC-CKR-5, CCCKR5, CD195, CKR-5, CKR5, CMKBR5...receptor 3B 5-HT3B HTR3C 5-hydroxytryptamine (serotonin) receptor 3, family member C - HTR3D 5-hydroxytryptamine... interleukin 5 (colony-stimulating factor, eosinophil) EDF, IL-5, TRF IL5RA interleukin 5 receptor, alpha...

  11. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...PAmCherry3 570 596 5 6.2 25 min Monomer pPAmCherry3-C1 - Mammalian Expression PAmKate 568 628 5 5.6 19 min Monomer...2014 Vol. 11 No. 5, pp.572-8 Yu et al. : Nature Communications, May 2014 Vol. 15 No. 5, p. 3626 Do you ...pSBFP2-C1 - Mammalian Expression Azurite 383 450 14 5 Prone to dimerization pLV-Azurite - Mammalian Lentiviral...pB18cmBFPAzurite - Bacterial Expression mAzurite 383 450 14 5 Monomer (A206K) mAzurite-N1 - Mammalian Expression...pmTurquoise2-N1 - Mammalian Expression CyPet 435 477 18 5 Monomer pCEP4CyPet-MAMM - Mammalian Expression pCyPet-C1...Structure Plasmids mKusabira-Orange (mKO) 548 559 31 5 4.5 hr Monomer pQC mKorange IX - Mammalian Expression...mRaspberry-N1 - Mammalian Expression TagRFP675 598 675 4 5 Prone to dimerization pTagRFP675-N1 - Mammalian Expression...

  12. Genetic Code Expansion

    Type
    Collection
    ...174719 pRSF-G1pCNPRS G1pCNPRS M. archaeon L-3-(2-cyano-5-pyridyl)alanine (pCNP) Bacterial TAG Thomas Huber ...Methanogenic archaeon 4-Fluoro-L-Tryptophan (4FTrp), 5-Fluoro-L-Tryptophan (5FTrp) Bacterial TAG Thomas Huber...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang...

  13. Validated gRNA Sequences

    Type
    Collection
    ... must be used with targets that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....
Showing: 1 - 13 of 13 results