Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 1,018 results for: CAL;

Showing: 61 - 80 of 1018 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...powerful tools to control gene expression and study biological targets. The tetracycline (tet) system is one...improvements. A synthetic Tet Response Element (TRE) typically features seven copies of tet O upstream of a minimal...or dox-dependent promoters (sometimes generally called Ptet) have been designed by combining tet O sequences... to a reverse Tet repressor, or rTetR, which specifically binds the TRE in the presence of tetracycline...safe harbor site, for iPSC differentiation into cortical neurons Michael Ward 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...

  2. CRISPR Plasmids - Yeast

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify ...

  3. Viral Vector Guides and Plasmids

    Type
    Collection
    ...vectors are popular for making stable cell lines or clinical use. Adenoviral Vector Guide | Adenoviral Plasmids...induce a strong immunogenic response, useful for clinical applications as vaccines. Selecting a Viral Vector... research goals. For example, AAV vectors are typically preferred for in vivo studies because of their...viral genome. Therefore, viruses used in research typically do not have the ability to propagate in the same...

  4. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...the plasmid that encodes the viral genome (typically called cis -plasmid or transfer plasmid). Helper ...research is that it is replication-limited and typically not known to cause disease in humans. For these... biosafety levels and elicit relatively low immunological effects in vivo . While AAVs can be handled ...

  5. COVID-19 Resources

    Type
    Collection
    ...novel virus strain from the Coronaviridae family called SARS-CoV-2. Scientists have been working at lightning... enzyme that cleaves precursor proteins to a biologically active state. The SARS-CoV-2 S protein contains...Cas13a ( pC013 ) for detection of SARS-CoV-2: A Scalable, Easy-to-Deploy, Protocol for Cas13-Based Detection...Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor . FURIN - Andersen,...

  6. Bacterial Expression Systems

    Type
    Collection
    ...bacteria as model systems to answer many interesting biological questions. Escherichia coli is the most widely...enterokinase, thrombin Signal peptides for periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI...purification tag combinations, including PelB tags for localization to the periplasm. The pCri System (Addgene #1000000058...protein of interest fused to FPs and monitor their localization in live cells. ID Plasmid Tags PI Additional...

  7. Cell Migration Consortium Plasmids

    Type
    Collection
    ...deposited plasmids include: Joan Brugge , Harvard Medical School Klaus Hahn , UNC Richard Hynes , MIT Rick...University of Virginia Denise Montell , University of California, Santa Barbara Martin Schwartz , Yale University...University of Illinois Ron Vale , University of California, San Francisco Browse Plasmids ID Plasmid Gene...

  8. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background Fluorescent...to use these fluorescent proteins to modulate biological activity. Early tools allow scientists to regulate...transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids...

  9. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael Davidson from...the ORFs are of mammalian origin and include localization data found below. In addition, the Davidson ...Expressions website for additional images, tutorials, optical microscopy protocols and resources. Or read our...

  10. AAV Viral Preps

    Type
    Collection
    ...Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1, MaCPNS1...AAV2, AAV5, AAV6, AAV8, AAV9, AAV11, AAVrg, the Caltech systemic serotypes, or others, it will be listed...

  11. Synthetic Biology - Overview

    Type
    Collection
    ...International Genetically Engineered Machine Foundation Registry of Standard Biological Parts - Repository...biology describes the rational engineering of biological systems for novel functions. Addgene is working...

  12. AAV Molecular Tools

    Type
    Collection
    ...of the voltage-gated Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani 34910 paavCAG-...pAAV-TBG-ER-TurboID TBG-driven, constitutive Expression of ER-localized TurboID (with HA and V5 tag). 8 Long 160857 pAAV-FLEx-ER-TurboID... Cre-dependent Cre-dependent expression of ER-localized TurboID (with HA and V5 tag). 8 Long Overexpression...

  13. Validated gRNA Sequences

    Type
    Collection
    ...GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut...TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...

  14. Plant Plasmids and Resources

    Type
    Collection
    ...repository contains many plasmid tools that were specifically designed for use in plants. These resources ...MoClo Plant Parts II and Infrastructure Kit for hierarchical assembly of plant multigene constructs - Johannes...an Old Favorite External Resources Arabidopsis Biological Resource Center (ABRC) (Link opens in a new window...

  15. Lentiviral Prep Service

    Type
    Collection
    ...libraries to screen for genes involved in specific biological processes. For more information, see our Guide...pooled libraries 92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...

  16. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster resonance energy...acceptor molecules and can therefore be used to calculate the distances between the donor and acceptor. ...were developed to be used as FRET standards to calibrate the numerous and disparate methods used to measure...

  17. CRISPR Plasmids - Plants

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...

  18. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Masato Kanemaki's lab has developed a simple and scalable CRISPR/Cas-based method to tag endogenous proteins...Geraldine Seydoux's lab has developed a systematic and scalable method to create marker-free mutations, insertions...co-integrated markers or footprints, and can be scaled up for systematic editing of multiple genes. Plasmids...

  19. CRISPR References and Information

    Type
    Collection
    ...collection of CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation...sgRNAs, genes, or pathways. For use with genome-scale CRISPR-Cas9 knockout screens (or GeCKO) technology...all-around platform for CRISPR knock-in design at scale. It uses an open-source algorithm to automate and...

  20. Luciferase Plasmid Collection

    Type
    Collection
    ...pH-stable OFP (Antares), and Nanoluc®. CalFlux VTN : An intracellular calcium sensor created by fusing NanoLuc...Malcolm Moore 51819 Syn-ATP Firefly (modified) CMV Optical reporter of presynaptic ATP Timothy Ryan 24348 ...
Showing: 61 - 80 of 1018 results