We narrowed to 76 results for: Drosophila
-
TypeCollection... Expression - Rubin lab plasmids for Drosophila expression pMT-puro - Inducible... plasmid with N-terminal Myc tag and attB for Drosophila transgenesis His Epitope tag pEZYmyc-His - C-...
-
Sequencing Primers
TypeGuide... 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC...mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...U6 promoter Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...for a discussion on conversion tract length in Drosophila. Elliot et al. (1998) suggests mammalian cells... -
CRISPR Plasmids - Bacteria
TypeCollection...Empty gRNA Vectors By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...Empty gRNA Vectors By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR... -
CRISPR Plasmids - Plants
TypeCollection...Empty gRNA Vectors By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR... -
Open Enzyme Collection
TypeCollection...DNA-Binding Protein 165579 pOpen-dromedNK dNK from Drosophila 165580 pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI... -
TALEN Plasmids and Kits
TypeCollection...generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 -... -
Immunology Research Plasmids and Resources
TypeCollection...homolog 2 (Drosophila) KIAA1568, SAX3 ROBO3 roundabout, axon guidance receptor, homolog 3 (Drosophila) FLJ21044...homolog 1 (Drosophila) MEGF4, MGC164811, SLIL1, SLIT3, Slit-1 SLIT2 slit homolog 2 (Drosophila) FLJ14420...homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless homolog 2 (Drosophila) FLJ25596...roundabout, axon guidance receptor, homolog 1 (Drosophila) DUTT1, FLJ21882, MGC131599, MGC133277, SAX3 ... -
Promoters
TypeGuide... Ac5 Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires...regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive Insect Strong promoter... -
CRISPR History and Development for Genome Engineering
TypeCollection... , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast... -
Modular Cloning Guide
TypeGuide...Genome Engineering, CRISPR, Mammalian Expression, Drosophila John Doench 180-plasmid toolkit for rapid creation... -
Optogenetics Guide
TypeGuide... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...adapted for use in mammalian cells, yeast, and Drosophila. Synchronization of secretory protein traffic... -
CRISPR Guide
TypeGuide...are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely used in... -
CRISPR Guide
TypeCollection...are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely used in...