We narrowed to 211 results for: cycs
-
TypeBlog Post...observed in humans. Thus, understanding their life cycle and processes with their regenerative abilities ...observing and manipulating the entire developmental cycle. A majority of studies involving axolotls focus ...
-
Five Popular Model Organisms
TypeBlog Post...grow and maintain in the lab, have a short life cycle of 8 to 14 days, and produce a large number of offspring...small, transparent worms that have a rapid life cycle and large brood sizes. The majority of C. elegans... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...the most common approaches is to use sequential cycles of primary and secondary antibody labeling and ...secondary, image again, inactivate, and repeat these cycles for all your targets. Of course, you’ll need to... -
Important Considerations When Using AAVs
TypeBlog Post...plan (for storage) Is planning to fail Freeze/Thaw Cycles Of course, one cannot truly predict the perfect...stable than other viruses, multiple freeze thaw cycles can still reduce AAV titer. For long term storage... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...drugs like BM Cyclin, fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available... -
p53 Pathway
TypeCollection... peptidase Cyclin B CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3... 3 Cyclin E CCNE1 CCNE2 Cyclin E1 or E2 Cyclin G CCNG1 CCNG2 Cyclin G1 or G2 CDC25 Cell division cycle...also known as PMAIP1 p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor ...best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in damaged cells...cycle 25C Cdk4/6 CDK4 CDK6 Cyclin-dependent kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase... -
Fluorescent Protein Guide: Biosensors
TypeCollection...:7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic AMP (cAMPr) for mammalian or insect...sensor for cyclic AMP. Sci Signal. 2018 Mar 6;11(520). pii: 11/520/eaah3738. Justin Blau cAMP (cyclic AMP) ...:4003-4012.e6. Xavier Nicol cyclic di-GMP FRET-based biosensor for cyclic-di-GMP measurement Asymmetrical...ratio. Nat Commun. 2013;4:2550. Gary Yellen cAMP (cyclic AMP) Yellow fluorescent cAMP indicator (Flamindo2...2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based cAMP indicator... 2022 Nov;19(11):1461-1471. Haining Zhong cAMP (cyclic AMP) RAB-ICUE red biosensor for monitoring cAMP...pii: 10.1038/s41556-018-0200-6. Jin Zhang cAMP (cyclic AMP) Yellow-emitting homoFRET/anisotropy ICUE cAMP... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...endosomal trafficking to signaling pathways to the cell cycle. Good tools for measuring intracellular pH are required...movement of two or more targeted loci during the cell cycle or cell differentiation. This tool should delight...visualization of 6 different organelles, a cell cycle indicator for mouse embryonic stem cells and a series... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post... separately inducible by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an...presence of the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the... -
Validated gRNA Sequences
TypeCollection... Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae TGCAAAGGTCCTAATGTATA 64384 activate S. pyogenes 23977949 Lu CYC1m promoter...TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TTACTGTATGTACATACAGT 64378... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...necessary. Run samples in a thermocycler using the following parameters: Cycles 1-20 (37 °C for 5 min, 20...20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling conditions allow for digestion and ligation...Run samples in a thermocycler using the following parameters: 95 °C for 15 min, 35 cycles of (95 °C for ...approach, the use of T4 PNK is omitted. Anneal in a thermocycler using the following parameters: 37 °C for 30... of intended genomic deletion. Run sample in thermocycler and run the following program: 65 °C for 6 min... Extract the gDNA from clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract... -
Bacterial Expression Systems
TypeCollection...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518 pDest...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster 36267...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170...pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes...-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes...GFP-rab11 WT Recycling endosomes Rab11a GFP Richard Pagano 12679 DsRed-rab11 WT Recycling endosomes Rab11a...41163 pEGFP PICH Centromeres (dependent on cell cycle) PICH EGFP Erich Nigg 158008 pCMV-mGold-Tubulin-... -
Plasmids for Stem Cell Research
TypeCollection...;318(5858):1917-20. Thomson Lentivirus Human Doxycycline-inducible expression of human Oct4, Sox2, Klf4...Cibelli Lentivirus Human Single polycistronic, doxycycline-inducible lentiviral vector for the expression...322(5903):945-9. Hochedlinger Lentivirus Mouse Doxycycline-inducible expression of mouse Oct4, Sox2, Klf4...-9. Jaenisch Lentivirus Mouse Polycistronic, doxycycline-inducible lentiviral vectors for the expression... 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible lentiviral expression of mouse Oct4...Aug 25. 126(4):663-76. Yamanaka piggyBac Mouse Doxycycline-inducible piggyBac transposon reprogramming system... 2011 Mar;21(3):518-29. Cheng piggyBac Mouse Doxycycline-inducible piggyBac transposon reprogramming system... -
AAV Molecular Tools
TypeCollection...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators... Tools These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...and rtTA. The cells were pulsed with 2µg/ml of Doxycycline for 2 hours, and imaged on the Keyence BZ-9000...dynamics are influenced by the relatively long life-cycle of a protein from expression to degradation. Chemical... -
Immunology Research Plasmids and Resources
TypeCollection...SCM-1, SCM-1a, SCM1, SCYC1 XCL2 chemokine (C motif) ligand 2 SCM-1b, SCM1B, SCYC2 XCR1 chemokine (C motif...CDC42 cell division cycle 42 (GTP binding protein, 25kDa) CDC42Hs, G25K CDK4 cyclin-dependent kinase 4 ... formation of a high avidity BCR through repeat cycles of expansion. Chemokines Chemokines, or chemotactic... formation of a high avidity BCR through repeat cycles of expansion. Symbol Name Synonyms AKT1 v-akt murine...HHT, HHT2, ORW2, SKR3, TSR-I ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type...BN, GRP-10, preproGRP, proGRP GUCA2A guanylate cyclase activator 2A (guanylin) GUANYLIN, GUCA2, STARA ... -
#Deckthelab Contest Winners 2017
TypeBlog Post...challenge for her lab mates to create the best-recycled lab supply ornament ever! & they totally succeed... -
New FLIS Plasmid (April Fools 2022)
TypeBlog Post... genetics research, for decades. Its short life cycle, reasonably close genetic homology to humans, and... -
2018 #DeckTheLab Contest Winners
TypeBlog Post...nosed reindeer from @ladiesinlabcoats Many teams recycled lab materials into holiday decorations. We appreciated...